Incidental Mutation 'R6772:Rpia'
ID532208
Institutional Source Beutler Lab
Gene Symbol Rpia
Ensembl Gene ENSMUSG00000053604
Gene Nameribose 5-phosphate isomerase A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6772 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location70765720-70792232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70785548 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 108 (I108V)
Ref Sequence ENSEMBL: ENSMUSP00000064158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066134]
Predicted Effect probably benign
Transcript: ENSMUST00000066134
AA Change: I108V

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000064158
Gene: ENSMUSG00000053604
AA Change: I108V

DomainStartEndE-ValueType
low complexity region 16 38 N/A INTRINSIC
low complexity region 56 66 N/A INTRINSIC
Pfam:Rib_5-P_isom_A 120 294 7.3e-65 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme, which catalyzes the reversible conversion between ribose-5-phosphate and ribulose-5-phosphate in the pentose-phosphate pathway. This gene is highly conserved in most organisms. The enzyme plays an essential role in the carbohydrate metabolism. Mutations in this gene cause ribose 5-phosphate isomerase deficiency. A pseudogene is found on chromosome 18. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,053 D1144V probably damaging Het
Ankrd13a A G 5: 114,801,743 H477R probably benign Het
Anxa3 A T 5: 96,811,113 I27F probably damaging Het
Aplf T C 6: 87,663,799 E76G possibly damaging Het
Bbs1 A G 19: 4,906,590 probably benign Het
Camk2a T C 18: 60,969,020 S332P probably benign Het
Casz1 T A 4: 148,943,206 F1013L probably damaging Het
Cd109 A T 9: 78,680,810 I707F possibly damaging Het
Cd4 G A 6: 124,872,458 T202I probably benign Het
Celsr1 A G 15: 86,030,782 S997P probably benign Het
Cfap77 T C 2: 29,054,939 T24A probably damaging Het
Dscaml1 G A 9: 45,710,311 R1019H probably damaging Het
Epb41l4b C A 4: 57,063,140 V517F probably benign Het
Exosc10 G A 4: 148,581,134 D818N probably damaging Het
Furin C T 7: 80,393,492 G324S probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifi206 T C 1: 173,481,207 M408V unknown Het
Kdm4a T C 4: 118,142,555 probably null Het
Neo1 T A 9: 58,902,976 Q1064L probably damaging Het
Nphp4 G A 4: 152,544,406 V750I probably benign Het
Pcdhac1 T C 18: 37,090,236 V34A probably benign Het
Pdk4 T C 6: 5,487,141 I302V probably benign Het
Prl6a1 A G 13: 27,319,048 D209G probably damaging Het
Pspn T C 17: 56,999,515 Q138R probably benign Het
Ptgs2 A G 1: 150,102,078 Y134C probably damaging Het
Rlbp1 G A 7: 79,384,050 probably benign Het
Tcaf1 A T 6: 42,675,276 H757Q probably damaging Het
Ttc8 A C 12: 98,943,589 S143R probably damaging Het
Uba6 A G 5: 86,147,073 probably null Het
Ubr4 A T 4: 139,467,230 K4280* probably null Het
Vmn2r15 C A 5: 109,286,372 S822I probably damaging Het
Vps53 A T 11: 76,179,498 M1K probably null Het
Zfp362 A G 4: 128,790,260 M18T possibly damaging Het
Zfp429 A G 13: 67,390,198 C376R probably damaging Het
Zfyve9 T C 4: 108,639,269 N1395S probably damaging Het
Zmynd8 T A 2: 165,807,601 Q857H probably benign Het
Other mutations in Rpia
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Rpia APN 6 70775102 splice site probably benign
R1228:Rpia UTSW 6 70791896 missense probably benign 0.10
R4629:Rpia UTSW 6 70766594 missense possibly damaging 0.46
R5249:Rpia UTSW 6 70783579 nonsense probably null
R6302:Rpia UTSW 6 70773501 missense probably damaging 0.96
R6932:Rpia UTSW 6 70773440 missense probably benign 0.00
R7718:Rpia UTSW 6 70766618 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACCGAAATCCTCTTTCCTAAG -3'
(R):5'- TAAAGTAGGTACCCGCCTTGC -3'

Sequencing Primer
(F):5'- TCTTTCCTAAGAGCAGAAACCCTCAG -3'
(R):5'- CACCTGTGCTATGAACTGTTG -3'
Posted On2018-08-29