Incidental Mutation 'R6772:Aplf'
ID532209
Institutional Source Beutler Lab
Gene Symbol Aplf
Ensembl Gene ENSMUSG00000030051
Gene Nameaprataxin and PNKP like factor
Synonyms2010301N04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R6772 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location87628424-87672193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87663799 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 76 (E76G)
Ref Sequence ENSEMBL: ENSMUSP00000032130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032130] [ENSMUST00000065997] [ENSMUST00000203209]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032130
AA Change: E76G

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032130
Gene: ENSMUSG00000030051
AA Change: E76G

DomainStartEndE-ValueType
SCOP:d1lgpa_ 6 105 2e-11 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 340 349 N/A INTRINSIC
Pfam:zf-CCHH 372 396 1.7e-16 PFAM
Pfam:zf-CCHH 414 437 6.8e-15 PFAM
low complexity region 456 471 N/A INTRINSIC
low complexity region 477 486 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000065997
AA Change: E55G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000066232
Gene: ENSMUSG00000030051
AA Change: E55G

DomainStartEndE-ValueType
SCOP:d1lgpa_ 14 84 7e-6 SMART
low complexity region 243 257 N/A INTRINSIC
low complexity region 319 328 N/A INTRINSIC
Pfam:zf-CCHH 351 376 1.7e-15 PFAM
Pfam:zf-CCHH 393 417 1.9e-15 PFAM
low complexity region 435 450 N/A INTRINSIC
low complexity region 456 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203209
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C2ORF13 is a component of the cellular response to chromosomal DNA single- and double-strand breaks (Iles et al., 2007 [PubMed 17353262]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased repair of gamma irradiation-induced DNA damage and increased microhomology at class switch recombination junctions in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,053 D1144V probably damaging Het
Ankrd13a A G 5: 114,801,743 H477R probably benign Het
Anxa3 A T 5: 96,811,113 I27F probably damaging Het
Bbs1 A G 19: 4,906,590 probably benign Het
Camk2a T C 18: 60,969,020 S332P probably benign Het
Casz1 T A 4: 148,943,206 F1013L probably damaging Het
Cd109 A T 9: 78,680,810 I707F possibly damaging Het
Cd4 G A 6: 124,872,458 T202I probably benign Het
Celsr1 A G 15: 86,030,782 S997P probably benign Het
Cfap77 T C 2: 29,054,939 T24A probably damaging Het
Dscaml1 G A 9: 45,710,311 R1019H probably damaging Het
Epb41l4b C A 4: 57,063,140 V517F probably benign Het
Exosc10 G A 4: 148,581,134 D818N probably damaging Het
Furin C T 7: 80,393,492 G324S probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifi206 T C 1: 173,481,207 M408V unknown Het
Kdm4a T C 4: 118,142,555 probably null Het
Neo1 T A 9: 58,902,976 Q1064L probably damaging Het
Nphp4 G A 4: 152,544,406 V750I probably benign Het
Pcdhac1 T C 18: 37,090,236 V34A probably benign Het
Pdk4 T C 6: 5,487,141 I302V probably benign Het
Prl6a1 A G 13: 27,319,048 D209G probably damaging Het
Pspn T C 17: 56,999,515 Q138R probably benign Het
Ptgs2 A G 1: 150,102,078 Y134C probably damaging Het
Rlbp1 G A 7: 79,384,050 probably benign Het
Rpia T C 6: 70,785,548 I108V probably benign Het
Tcaf1 A T 6: 42,675,276 H757Q probably damaging Het
Ttc8 A C 12: 98,943,589 S143R probably damaging Het
Uba6 A G 5: 86,147,073 probably null Het
Ubr4 A T 4: 139,467,230 K4280* probably null Het
Vmn2r15 C A 5: 109,286,372 S822I probably damaging Het
Vps53 A T 11: 76,179,498 M1K probably null Het
Zfp362 A G 4: 128,790,260 M18T possibly damaging Het
Zfp429 A G 13: 67,390,198 C376R probably damaging Het
Zfyve9 T C 4: 108,639,269 N1395S probably damaging Het
Zmynd8 T A 2: 165,807,601 Q857H probably benign Het
Other mutations in Aplf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Aplf APN 6 87668408 splice site probably benign
IGL01304:Aplf APN 6 87641900 missense possibly damaging 0.71
IGL02267:Aplf APN 6 87658964 missense probably damaging 1.00
R0294:Aplf UTSW 6 87646245 missense probably benign 0.02
R0352:Aplf UTSW 6 87653884 missense probably benign 0.01
R0445:Aplf UTSW 6 87663752 missense probably damaging 1.00
R0959:Aplf UTSW 6 87646083 missense probably benign 0.24
R1127:Aplf UTSW 6 87646291 missense probably benign 0.00
R1583:Aplf UTSW 6 87646033 missense probably damaging 1.00
R2878:Aplf UTSW 6 87668427 nonsense probably null
R3617:Aplf UTSW 6 87671883 missense possibly damaging 0.85
R4708:Aplf UTSW 6 87663757 missense probably damaging 1.00
R4823:Aplf UTSW 6 87646255 missense probably damaging 1.00
R4919:Aplf UTSW 6 87630064 missense possibly damaging 0.94
R4941:Aplf UTSW 6 87668423 missense probably damaging 1.00
R4941:Aplf UTSW 6 87646349 missense probably benign 0.00
R5208:Aplf UTSW 6 87642026 splice site probably null
R5575:Aplf UTSW 6 87646147 missense probably benign 0.02
R6271:Aplf UTSW 6 87646248 missense possibly damaging 0.88
R6381:Aplf UTSW 6 87658977 missense probably damaging 0.96
R6906:Aplf UTSW 6 87630086 missense possibly damaging 0.65
R6975:Aplf UTSW 6 87646086 missense probably damaging 0.98
R7015:Aplf UTSW 6 87641902 missense probably damaging 0.99
R7038:Aplf UTSW 6 87653823 nonsense probably null
R7296:Aplf UTSW 6 87646215 missense probably damaging 0.99
R7778:Aplf UTSW 6 87658202 intron probably null
Predicted Primers PCR Primer
(F):5'- TGACTCAACCCTAGAGTGATTTCC -3'
(R):5'- ATTGCAGTCAATGGTGCCAG -3'

Sequencing Primer
(F):5'- TCCCTGAAGCATCTGTGAAG -3'
(R):5'- AGTCAATGGTGCCAGGCTCAC -3'
Posted On2018-08-29