Incidental Mutation 'R6772:Ttc8'
ID532217
Institutional Source Beutler Lab
Gene Symbol Ttc8
Ensembl Gene ENSMUSG00000021013
Gene Nametetratricopeptide repeat domain 8
SynonymsBBS8, 0610012F22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock #R6772 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location98920574-98983238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 98943589 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 143 (S143R)
Ref Sequence ENSEMBL: ENSMUSP00000082190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079146] [ENSMUST00000085109] [ENSMUST00000132878]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079146
AA Change: S153R

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078148
Gene: ENSMUSG00000021013
AA Change: S153R

DomainStartEndE-ValueType
Blast:TPR 4 37 5e-12 BLAST
TPR 225 258 2.35e-1 SMART
TPR 292 325 9.68e-3 SMART
Blast:TPR 326 359 3e-14 BLAST
TPR 360 393 2.26e-3 SMART
TPR 397 430 1.91e-1 SMART
TPR 431 464 1.81e-2 SMART
Blast:TPR 465 498 7e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000085109
AA Change: S143R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082190
Gene: ENSMUSG00000021013
AA Change: S143R

DomainStartEndE-ValueType
Blast:TPR 4 37 4e-12 BLAST
TPR 215 248 2.35e-1 SMART
TPR 282 315 9.68e-3 SMART
Blast:TPR 316 349 3e-14 BLAST
TPR 350 383 2.26e-3 SMART
TPR 387 420 1.91e-1 SMART
TPR 421 454 1.81e-2 SMART
Blast:TPR 455 488 7e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000132878
AA Change: S93R

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115828
Gene: ENSMUSG00000021013
AA Change: S93R

DomainStartEndE-ValueType
SCOP:d1a17__ 128 206 2e-5 SMART
Blast:TPR 165 198 8e-18 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has been directly linked to Bardet-Biedl syndrome. The primary features of this syndrome include retinal dystrophy, obesity, polydactyly, renal abnormalities and learning disabilities. Experimentation in non-human eukaryotes suggests that this gene is expressed in ciliated cells and that it is involved in the formation of cilia. A mutation in this gene has also been implicated in nonsyndromic retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null mutation display partial postnatal lethality with slow postnatal weight gain, age related obesity, impaired olfation, loss of cilia from the olfactory epithelium, impaired targeting of olfactory sensory neuron axons, retinal degeneration, and mild renal tubule dilation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,053 D1144V probably damaging Het
Ankrd13a A G 5: 114,801,743 H477R probably benign Het
Anxa3 A T 5: 96,811,113 I27F probably damaging Het
Aplf T C 6: 87,663,799 E76G possibly damaging Het
Bbs1 A G 19: 4,906,590 probably benign Het
Camk2a T C 18: 60,969,020 S332P probably benign Het
Casz1 T A 4: 148,943,206 F1013L probably damaging Het
Cd109 A T 9: 78,680,810 I707F possibly damaging Het
Cd4 G A 6: 124,872,458 T202I probably benign Het
Celsr1 A G 15: 86,030,782 S997P probably benign Het
Cfap77 T C 2: 29,054,939 T24A probably damaging Het
Dscaml1 G A 9: 45,710,311 R1019H probably damaging Het
Epb41l4b C A 4: 57,063,140 V517F probably benign Het
Exosc10 G A 4: 148,581,134 D818N probably damaging Het
Furin C T 7: 80,393,492 G324S probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifi206 T C 1: 173,481,207 M408V unknown Het
Kdm4a T C 4: 118,142,555 probably null Het
Neo1 T A 9: 58,902,976 Q1064L probably damaging Het
Nphp4 G A 4: 152,544,406 V750I probably benign Het
Pcdhac1 T C 18: 37,090,236 V34A probably benign Het
Pdk4 T C 6: 5,487,141 I302V probably benign Het
Prl6a1 A G 13: 27,319,048 D209G probably damaging Het
Pspn T C 17: 56,999,515 Q138R probably benign Het
Ptgs2 A G 1: 150,102,078 Y134C probably damaging Het
Rlbp1 G A 7: 79,384,050 probably benign Het
Rpia T C 6: 70,785,548 I108V probably benign Het
Tcaf1 A T 6: 42,675,276 H757Q probably damaging Het
Uba6 A G 5: 86,147,073 probably null Het
Ubr4 A T 4: 139,467,230 K4280* probably null Het
Vmn2r15 C A 5: 109,286,372 S822I probably damaging Het
Vps53 A T 11: 76,179,498 M1K probably null Het
Zfp362 A G 4: 128,790,260 M18T possibly damaging Het
Zfp429 A G 13: 67,390,198 C376R probably damaging Het
Zfyve9 T C 4: 108,639,269 N1395S probably damaging Het
Zmynd8 T A 2: 165,807,601 Q857H probably benign Het
Other mutations in Ttc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Ttc8 APN 12 98976018 missense probably damaging 0.96
IGL01139:Ttc8 APN 12 98964545 nonsense probably null
IGL02179:Ttc8 APN 12 98964537 missense possibly damaging 0.87
IGL02715:Ttc8 APN 12 98943920 splice site probably benign
IGL02958:Ttc8 APN 12 98964544 missense probably benign 0.03
IGL03249:Ttc8 APN 12 98943821 splice site probably benign
P0035:Ttc8 UTSW 12 98976416 splice site probably benign
R0606:Ttc8 UTSW 12 98943459 splice site probably benign
R1005:Ttc8 UTSW 12 98937144 missense probably benign 0.11
R1584:Ttc8 UTSW 12 98920764 missense probably benign 0.01
R1628:Ttc8 UTSW 12 98982521 missense probably benign 0.07
R1706:Ttc8 UTSW 12 98943883 missense probably benign 0.02
R4585:Ttc8 UTSW 12 98982530 missense probably benign
R4720:Ttc8 UTSW 12 98979809 missense possibly damaging 0.94
R4879:Ttc8 UTSW 12 98942303 missense possibly damaging 0.55
R5110:Ttc8 UTSW 12 98942303 missense probably benign 0.25
R6272:Ttc8 UTSW 12 98982494 missense possibly damaging 0.63
R6465:Ttc8 UTSW 12 98964570 missense probably damaging 1.00
R6620:Ttc8 UTSW 12 98957320 missense possibly damaging 0.95
R6708:Ttc8 UTSW 12 98943532 missense probably damaging 0.99
R6901:Ttc8 UTSW 12 98961476 missense probably damaging 1.00
R7060:Ttc8 UTSW 12 98943467 missense probably benign
R7117:Ttc8 UTSW 12 98976502 missense possibly damaging 0.63
R7174:Ttc8 UTSW 12 98974701 missense possibly damaging 0.79
R7385:Ttc8 UTSW 12 98942288 missense possibly damaging 0.78
R7447:Ttc8 UTSW 12 98943872 missense probably damaging 0.97
R7589:Ttc8 UTSW 12 98976437 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTTCAAATCCTGACCAGACC -3'
(R):5'- AGCTGAAAACCTTCTCTTGGAAC -3'

Sequencing Primer
(F):5'- GACCAGACCATCTCCTTAATTGATC -3'
(R):5'- CTCTTGGAACATAGAGTTTCGTATGC -3'
Posted On2018-08-29