Incidental Mutation 'R6772:Prl6a1'
ID532218
Institutional Source Beutler Lab
Gene Symbol Prl6a1
Ensembl Gene ENSMUSG00000069259
Gene Nameprolactin family 6, subfamily a, member 1
SynonymsPLP-B, Prlpb
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R6772 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location27312627-27319252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27319048 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 209 (D209G)
Ref Sequence ENSEMBL: ENSMUSP00000089269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091679] [ENSMUST00000091680]
Predicted Effect probably damaging
Transcript: ENSMUST00000091679
AA Change: D214G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089268
Gene: ENSMUSG00000069259
AA Change: D214G

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:Hormone_1 21 235 8e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091680
AA Change: D209G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089269
Gene: ENSMUSG00000069259
AA Change: D209G

DomainStartEndE-ValueType
Pfam:Hormone_1 16 230 1.1e-61 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,053 D1144V probably damaging Het
Ankrd13a A G 5: 114,801,743 H477R probably benign Het
Anxa3 A T 5: 96,811,113 I27F probably damaging Het
Aplf T C 6: 87,663,799 E76G possibly damaging Het
Bbs1 A G 19: 4,906,590 probably benign Het
Camk2a T C 18: 60,969,020 S332P probably benign Het
Casz1 T A 4: 148,943,206 F1013L probably damaging Het
Cd109 A T 9: 78,680,810 I707F possibly damaging Het
Cd4 G A 6: 124,872,458 T202I probably benign Het
Celsr1 A G 15: 86,030,782 S997P probably benign Het
Cfap77 T C 2: 29,054,939 T24A probably damaging Het
Dscaml1 G A 9: 45,710,311 R1019H probably damaging Het
Epb41l4b C A 4: 57,063,140 V517F probably benign Het
Exosc10 G A 4: 148,581,134 D818N probably damaging Het
Furin C T 7: 80,393,492 G324S probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifi206 T C 1: 173,481,207 M408V unknown Het
Kdm4a T C 4: 118,142,555 probably null Het
Neo1 T A 9: 58,902,976 Q1064L probably damaging Het
Nphp4 G A 4: 152,544,406 V750I probably benign Het
Pcdhac1 T C 18: 37,090,236 V34A probably benign Het
Pdk4 T C 6: 5,487,141 I302V probably benign Het
Pspn T C 17: 56,999,515 Q138R probably benign Het
Ptgs2 A G 1: 150,102,078 Y134C probably damaging Het
Rlbp1 G A 7: 79,384,050 probably benign Het
Rpia T C 6: 70,785,548 I108V probably benign Het
Tcaf1 A T 6: 42,675,276 H757Q probably damaging Het
Ttc8 A C 12: 98,943,589 S143R probably damaging Het
Uba6 A G 5: 86,147,073 probably null Het
Ubr4 A T 4: 139,467,230 K4280* probably null Het
Vmn2r15 C A 5: 109,286,372 S822I probably damaging Het
Vps53 A T 11: 76,179,498 M1K probably null Het
Zfp362 A G 4: 128,790,260 M18T possibly damaging Het
Zfp429 A G 13: 67,390,198 C376R probably damaging Het
Zfyve9 T C 4: 108,639,269 N1395S probably damaging Het
Zmynd8 T A 2: 165,807,601 Q857H probably benign Het
Other mutations in Prl6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Prl6a1 APN 13 27316364 missense possibly damaging 0.72
IGL01688:Prl6a1 APN 13 27317986 missense probably damaging 1.00
IGL01922:Prl6a1 APN 13 27315360 missense possibly damaging 0.57
IGL02059:Prl6a1 APN 13 27315365 missense probably benign 0.02
IGL03170:Prl6a1 APN 13 27315423 missense possibly damaging 0.95
R0027:Prl6a1 UTSW 13 27318028 missense probably damaging 1.00
R0027:Prl6a1 UTSW 13 27318028 missense probably damaging 1.00
R0049:Prl6a1 UTSW 13 27317997 missense probably damaging 0.99
R0606:Prl6a1 UTSW 13 27314194 intron probably benign
R0944:Prl6a1 UTSW 13 27318166 splice site probably benign
R1518:Prl6a1 UTSW 13 27318927 missense possibly damaging 0.72
R1518:Prl6a1 UTSW 13 27318928 missense probably null 0.19
R1566:Prl6a1 UTSW 13 27315427 missense possibly damaging 0.84
R1621:Prl6a1 UTSW 13 27318010 missense probably benign 0.01
R2011:Prl6a1 UTSW 13 27315369 missense probably benign 0.00
R2058:Prl6a1 UTSW 13 27319098 missense probably benign 0.05
R2937:Prl6a1 UTSW 13 27315320 missense probably damaging 0.98
R3079:Prl6a1 UTSW 13 27319000 missense possibly damaging 0.71
R4685:Prl6a1 UTSW 13 27316324 missense probably benign 0.00
R4856:Prl6a1 UTSW 13 27319000 missense probably damaging 0.98
R4886:Prl6a1 UTSW 13 27319000 missense probably damaging 0.98
R5495:Prl6a1 UTSW 13 27312671 missense possibly damaging 0.95
R5923:Prl6a1 UTSW 13 27316363 missense probably benign 0.08
R7411:Prl6a1 UTSW 13 27318142 missense probably damaging 1.00
R7501:Prl6a1 UTSW 13 27316299 missense possibly damaging 0.69
R7549:Prl6a1 UTSW 13 27318971 missense probably damaging 0.96
R7563:Prl6a1 UTSW 13 27314238 critical splice donor site probably null
R7773:Prl6a1 UTSW 13 27318142 missense probably damaging 1.00
Z1177:Prl6a1 UTSW 13 27315321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTCACACTACTTTGGCATAGAGAC -3'
(R):5'- TATTACAGGGTGAAATGAGATGTCG -3'

Sequencing Primer
(F):5'- TCTAATTTCATCCCAAGAGTTCTTTC -3'
(R):5'- AGACATCAACATGTTTAAAGAGTCTG -3'
Posted On2018-08-29