Incidental Mutation 'R6772:Pspn'
ID532221
Institutional Source Beutler Lab
Gene Symbol Pspn
Ensembl Gene ENSMUSG00000002664
Gene Namepersephin
SynonymsPSP
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6772 (G1)
Quality Score182.009
Status Validated
Chromosome17
Chromosomal Location56999457-57000018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56999515 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 138 (Q138R)
Ref Sequence ENSEMBL: ENSMUSP00000002740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002733] [ENSMUST00000002735] [ENSMUST00000002737] [ENSMUST00000002740] [ENSMUST00000074141]
Predicted Effect probably benign
Transcript: ENSMUST00000002733
SMART Domains Protein: ENSMUSP00000002733
Gene: ENSMUSG00000002658

DomainStartEndE-ValueType
Pfam:TFIIF_alpha 2 508 2.6e-200 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000002735
SMART Domains Protein: ENSMUSP00000002735
Gene: ENSMUSG00000002660

DomainStartEndE-ValueType
Pfam:CLP_protease 63 244 8.8e-82 PFAM
low complexity region 259 270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000002737
SMART Domains Protein: ENSMUSP00000002737
Gene: ENSMUSG00000002661

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 64 203 8.2e-14 PFAM
low complexity region 206 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000002740
AA Change: Q138R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002740
Gene: ENSMUSG00000002664
AA Change: Q138R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TGFB 66 155 1.24e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074141
SMART Domains Protein: ENSMUSP00000073775
Gene: ENSMUSG00000002661

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 63 145 3.8e-12 PFAM
low complexity region 148 161 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the GDNF (glial cell line-derived neurotrophic factor) subfamily and TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein signals through the RET receptor tyrosine kinase and a GPI-linked coreceptor, and promotes survival of neuronal populations. This protein may play a role in cell death, and nervous system development and function. Mice lacking a functional copy of this gene exhibit hypersensitivity to cerebral ischemia. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are developmentally and behaviorally normal but show increased susceptibility to focal cerebral ischemia and stroke following middle cerebral artery occlusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,053 D1144V probably damaging Het
Ankrd13a A G 5: 114,801,743 H477R probably benign Het
Anxa3 A T 5: 96,811,113 I27F probably damaging Het
Aplf T C 6: 87,663,799 E76G possibly damaging Het
Bbs1 A G 19: 4,906,590 probably benign Het
Camk2a T C 18: 60,969,020 S332P probably benign Het
Casz1 T A 4: 148,943,206 F1013L probably damaging Het
Cd109 A T 9: 78,680,810 I707F possibly damaging Het
Cd4 G A 6: 124,872,458 T202I probably benign Het
Celsr1 A G 15: 86,030,782 S997P probably benign Het
Cfap77 T C 2: 29,054,939 T24A probably damaging Het
Dscaml1 G A 9: 45,710,311 R1019H probably damaging Het
Epb41l4b C A 4: 57,063,140 V517F probably benign Het
Exosc10 G A 4: 148,581,134 D818N probably damaging Het
Furin C T 7: 80,393,492 G324S probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifi206 T C 1: 173,481,207 M408V unknown Het
Kdm4a T C 4: 118,142,555 probably null Het
Neo1 T A 9: 58,902,976 Q1064L probably damaging Het
Nphp4 G A 4: 152,544,406 V750I probably benign Het
Pcdhac1 T C 18: 37,090,236 V34A probably benign Het
Pdk4 T C 6: 5,487,141 I302V probably benign Het
Prl6a1 A G 13: 27,319,048 D209G probably damaging Het
Ptgs2 A G 1: 150,102,078 Y134C probably damaging Het
Rlbp1 G A 7: 79,384,050 probably benign Het
Rpia T C 6: 70,785,548 I108V probably benign Het
Tcaf1 A T 6: 42,675,276 H757Q probably damaging Het
Ttc8 A C 12: 98,943,589 S143R probably damaging Het
Uba6 A G 5: 86,147,073 probably benign Het
Ubr4 A T 4: 139,467,230 K4280* probably null Het
Vmn2r15 C A 5: 109,286,372 S822I probably damaging Het
Vps53 A T 11: 76,179,498 M1K probably null Het
Zfp362 A G 4: 128,790,260 M18T possibly damaging Het
Zfp429 A G 13: 67,390,198 C376R probably damaging Het
Zfyve9 T C 4: 108,639,269 N1395S probably damaging Het
Zmynd8 T A 2: 165,807,601 Q857H probably benign Het
Other mutations in Pspn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Pspn APN 17 56999629 missense probably benign 0.00
IGL02986:Pspn APN 17 56999853 unclassified probably benign
IGL03142:Pspn APN 17 56999566 missense probably benign 0.00
R0513:Pspn UTSW 17 56999720 missense probably damaging 1.00
R6145:Pspn UTSW 17 56999467 missense probably damaging 1.00
R7028:Pspn UTSW 17 56999978 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CACACTCTTAAGGCCACGAG -3'
(R):5'- AGAGCCTTGGCTGGTTCATG -3'

Sequencing Primer
(F):5'- GGCCACGAGAATATCATTTATTGC -3'
(R):5'- TTCATGCCGACTGTGGAGC -3'
Posted On2018-08-29