Incidental Mutation 'R6773:Aqr'
ID532230
Institutional Source Beutler Lab
Gene Symbol Aqr
Ensembl Gene ENSMUSG00000040383
Gene Nameaquarius
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6773 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location114101170-114187024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114148996 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 319 (N319K)
Ref Sequence ENSEMBL: ENSMUSP00000047157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043160
AA Change: N319K

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: N319K

DomainStartEndE-ValueType
Pfam:Aquarius_N 18 802 N/A PFAM
Pfam:ResIII 797 911 8.2e-7 PFAM
Pfam:AAA_11 801 1111 9.6e-32 PFAM
Pfam:AAA_19 807 894 3.7e-11 PFAM
Pfam:AAA_12 1119 1312 2.1e-27 PFAM
low complexity region 1394 1417 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102543
AA Change: N319K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: N319K

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
low complexity region 762 776 N/A INTRINSIC
Pfam:AAA_11 801 1111 3.2e-32 PFAM
Pfam:AAA_19 807 893 6.5e-11 PFAM
Pfam:AAA_12 1119 1312 2.6e-27 PFAM
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
Meta Mutation Damage Score 0.0580 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 98% (44/45)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp6 A G 15: 99,602,677 D161G probably damaging Het
Asns C A 6: 7,676,284 R424L probably benign Het
Atp4a T C 7: 30,715,377 V197A probably damaging Het
Ccdc70 A G 8: 21,973,305 E37G probably damaging Het
Ccdc88b A T 19: 6,849,041 V1102E possibly damaging Het
Cd82 G A 2: 93,421,876 A130V probably benign Het
Cfap46 T C 7: 139,642,561 probably benign Het
Cnot6l A C 5: 96,094,299 C188W probably damaging Het
Cxcr6 A T 9: 123,810,290 T119S possibly damaging Het
Dok7 G A 5: 35,077,184 R193H probably damaging Het
Dpy19l1 A T 9: 24,440,772 S386T probably damaging Het
Frem3 A C 8: 80,611,815 T246P probably damaging Het
Gm29666 A T 15: 84,914,159 I67K unknown Het
Gm9774 T A 3: 92,429,249 I49F probably damaging Het
Gpr153 T A 4: 152,279,300 V59E probably damaging Het
Inpp4b G A 8: 81,856,620 probably benign Het
Kcnj13 T C 1: 87,386,760 I247V possibly damaging Het
Klri1 C T 6: 129,703,547 V91M possibly damaging Het
M1ap T A 6: 82,968,080 D118E probably damaging Het
Map4 T C 9: 110,034,925 V406A probably benign Het
Nedd4l T C 18: 65,167,551 V369A probably benign Het
Olfr206 A T 16: 59,345,216 L162I probably damaging Het
Otud4 A G 8: 79,643,806 Y71C possibly damaging Het
Plcl1 A G 1: 55,751,302 N1044D probably benign Het
Ppp4r3b T A 11: 29,205,639 M114K probably benign Het
Prune1 T C 3: 95,263,771 D114G probably damaging Het
Rad54l2 A T 9: 106,693,317 V1268D probably benign Het
Rbbp6 A G 7: 122,999,355 probably benign Het
Rimbp3 A T 16: 17,209,015 E101V probably damaging Het
Rit1 C T 3: 88,726,369 probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Shisa9 A G 16: 11,985,028 T150A probably damaging Het
Smpdl3a T C 10: 57,802,437 V112A probably damaging Het
Strada T A 11: 106,164,907 I305F probably damaging Het
Svep1 C T 4: 58,049,146 E3454K possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tmem259 T C 10: 79,977,588 D519G possibly damaging Het
Tns1 T C 1: 73,919,707 Q445R probably damaging Het
Topbp1 A G 9: 103,343,692 D20G possibly damaging Het
Trbv5 G T 6: 41,062,617 W52L probably damaging Het
Trpc6 A T 9: 8,634,057 H379L probably damaging Het
Tulp1 T C 17: 28,362,902 K193E probably damaging Het
Unc80 T C 1: 66,651,543 V2459A probably benign Het
Vps50 T C 6: 3,592,560 V731A probably benign Het
Other mutations in Aqr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Aqr APN 2 114125942 missense possibly damaging 0.90
IGL00694:Aqr APN 2 114151525 missense probably damaging 1.00
IGL02113:Aqr APN 2 114120027 nonsense probably null
IGL02297:Aqr APN 2 114150481 missense probably benign 0.24
IGL02380:Aqr APN 2 114109936 missense probably damaging 1.00
IGL02410:Aqr APN 2 114136917 missense possibly damaging 0.85
IGL02413:Aqr APN 2 114118780 missense possibly damaging 0.87
IGL02474:Aqr APN 2 114112646 missense probably damaging 1.00
IGL02941:Aqr APN 2 114113354 missense probably damaging 1.00
IGL02981:Aqr APN 2 114134824 splice site probably benign
IGL03001:Aqr APN 2 114146919 missense probably benign
IGL03092:Aqr APN 2 114158943 missense probably benign 0.38
IGL03222:Aqr APN 2 114121256 missense probably damaging 1.00
capricorn UTSW 2 114105882 missense probably damaging 1.00
Goat UTSW 2 114157575 missense probably damaging 1.00
Pliades UTSW 2 114132976 missense probably damaging 1.00
sagittarius UTSW 2 114149016 missense probably damaging 1.00
Zodiac UTSW 2 114108109 missense probably damaging 0.96
PIT4531001:Aqr UTSW 2 114130734 missense possibly damaging 0.94
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0152:Aqr UTSW 2 114159010 missense probably benign 0.07
R0352:Aqr UTSW 2 114170052 missense probably damaging 1.00
R0371:Aqr UTSW 2 114157604 missense possibly damaging 0.80
R0374:Aqr UTSW 2 114130611 missense probably damaging 1.00
R0550:Aqr UTSW 2 114132976 missense probably damaging 1.00
R0604:Aqr UTSW 2 114130604 missense probably benign 0.00
R0685:Aqr UTSW 2 114140977 missense probably damaging 1.00
R1236:Aqr UTSW 2 114116655 missense probably damaging 1.00
R1434:Aqr UTSW 2 114150409 missense probably damaging 1.00
R1806:Aqr UTSW 2 114161652 missense probably damaging 1.00
R2154:Aqr UTSW 2 114137004 missense probably damaging 1.00
R2185:Aqr UTSW 2 114130534 critical splice donor site probably null
R2377:Aqr UTSW 2 114140940 missense possibly damaging 0.58
R2862:Aqr UTSW 2 114136917 missense probably damaging 1.00
R3615:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3616:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3713:Aqr UTSW 2 114118669 splice site probably benign
R3715:Aqr UTSW 2 114118669 splice site probably benign
R4586:Aqr UTSW 2 114112577 missense probably benign 0.06
R4663:Aqr UTSW 2 114161666 nonsense probably null
R4809:Aqr UTSW 2 114175214 utr 5 prime probably benign
R4887:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4888:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4952:Aqr UTSW 2 114109937 missense probably damaging 1.00
R4974:Aqr UTSW 2 114113351 missense probably damaging 1.00
R5050:Aqr UTSW 2 114112609 nonsense probably null
R5050:Aqr UTSW 2 114170025 critical splice donor site probably null
R5213:Aqr UTSW 2 114113327 missense probably damaging 1.00
R5263:Aqr UTSW 2 114116578 missense probably damaging 1.00
R5470:Aqr UTSW 2 114157575 missense probably damaging 1.00
R5488:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5489:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5567:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5570:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5641:Aqr UTSW 2 114149034 missense probably damaging 1.00
R5685:Aqr UTSW 2 114156265 missense possibly damaging 0.87
R5963:Aqr UTSW 2 114126961 missense probably damaging 1.00
R5992:Aqr UTSW 2 114143049 nonsense probably null
R6015:Aqr UTSW 2 114175165 start codon destroyed probably null 0.53
R6253:Aqr UTSW 2 114156277 missense possibly damaging 0.93
R6264:Aqr UTSW 2 114109964 missense probably damaging 1.00
R6877:Aqr UTSW 2 114116571 nonsense probably null
R7211:Aqr UTSW 2 114134723 missense probably benign 0.01
R7232:Aqr UTSW 2 114105882 missense probably damaging 1.00
R7308:Aqr UTSW 2 114104062 missense possibly damaging 0.86
R7396:Aqr UTSW 2 114119946 nonsense probably null
R7490:Aqr UTSW 2 114158868 critical splice donor site probably null
R7526:Aqr UTSW 2 114108109 missense probably damaging 0.96
R7629:Aqr UTSW 2 114114593 missense probably damaging 1.00
R7828:Aqr UTSW 2 114149016 missense probably damaging 1.00
R8037:Aqr UTSW 2 114161680 missense probably damaging 1.00
R8166:Aqr UTSW 2 114113325 missense possibly damaging 0.95
R8712:Aqr UTSW 2 114118877 missense probably damaging 1.00
Z1176:Aqr UTSW 2 114108122 missense probably damaging 0.98
Z1176:Aqr UTSW 2 114109991 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TTTCAGATGGACCATGAAAGTCAC -3'
(R):5'- GGATATGCTCTCAAGTATTTGCTG -3'

Sequencing Primer
(F):5'- GTAATGAGCCTCTGAACCTGTAAGC -3'
(R):5'- GCTCTCAAGTATTTGCTGAATAATGC -3'
Posted On2018-08-29