Mutagenetix > Incidental Mutation

Incidental Mutation 'R6773:Atp4a'

532242

Institutional Source

Beutler Lab

Gene Symbol

Atp4a

Ensembl Gene

ENSMUSG00000005553

Gene Name

ATPase, H+/K+ exchanging, gastric, alpha polypeptide

Synonyms

H+/K+-ATPase alpha, H+K+-transporting alpha 1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.132) question?

Stock #

R6773 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30712209-30725534 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30715377 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 197 (V197A)

Ref Sequence

ENSEMBL: ENSMUSP00000131964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000005692
AA Change: V197A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: V197A

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	5.4e-23	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	144	375	1.1e-57	PFAM
Pfam:Hydrolase	380	739	5.3e-16	PFAM
Pfam:HAD	383	736	1.9e-18	PFAM
Pfam:Cation_ATPase	436	531	1.6e-24	PFAM
Pfam:Cation_ATPase_C	809	1019	4.8e-43	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170371
AA Change: V197A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: V197A

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	4.9e-28	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	145	376	1e-62	PFAM
Pfam:Hydrolase	380	730	9.3e-25	PFAM
Pfam:HAD	383	727	2.1e-15	PFAM
Pfam:Hydrolase_like2	436	531	4e-25	PFAM
Pfam:Cation_ATPase_C	800	1010	1.5e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171014

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 96.8%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aqp6	A	G	15: 99,602,677	D161G	probably damaging	Het
Aqr	A	T	2: 114,148,996	N319K	possibly damaging	Het
Asns	C	A	6: 7,676,284	R424L	probably benign	Het
Ccdc70	A	G	8: 21,973,305	E37G	probably damaging	Het
Ccdc88b	A	T	19: 6,849,041	V1102E	possibly damaging	Het
Cd82	G	A	2: 93,421,876	A130V	probably benign	Het
Cfap46	T	C	7: 139,642,561		probably benign	Het
Cnot6l	A	C	5: 96,094,299	C188W	probably damaging	Het
Cxcr6	A	T	9: 123,810,290	T119S	possibly damaging	Het
Dok7	G	A	5: 35,077,184	R193H	probably damaging	Het
Dpy19l1	A	T	9: 24,440,772	S386T	probably damaging	Het
Frem3	A	C	8: 80,611,815	T246P	probably damaging	Het
Gm29666	A	T	15: 84,914,159	I67K	unknown	Het
Gm9774	T	A	3: 92,429,249	I49F	probably damaging	Het
Gpr153	T	A	4: 152,279,300	V59E	probably damaging	Het
Inpp4b	G	A	8: 81,856,620		probably benign	Het
Kcnj13	T	C	1: 87,386,760	I247V	possibly damaging	Het
Klri1	C	T	6: 129,703,547	V91M	possibly damaging	Het
M1ap	T	A	6: 82,968,080	D118E	probably damaging	Het
Map4	T	C	9: 110,034,925	V406A	probably benign	Het
Nedd4l	T	C	18: 65,167,551	V369A	probably benign	Het
Olfr206	A	T	16: 59,345,216	L162I	probably damaging	Het
Otud4	A	G	8: 79,643,806	Y71C	possibly damaging	Het
Plcl1	A	G	1: 55,751,302	N1044D	probably benign	Het
Ppp4r3b	T	A	11: 29,205,639	M114K	probably benign	Het
Prune1	T	C	3: 95,263,771	D114G	probably damaging	Het
Rad54l2	A	T	9: 106,693,317	V1268D	probably benign	Het
Rbbp6	A	G	7: 122,999,355		probably benign	Het
Rimbp3	A	T	16: 17,209,015	E101V	probably damaging	Het
Rit1	C	T	3: 88,726,369		probably null	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Homo
Shisa9	A	G	16: 11,985,028	T150A	probably damaging	Het
Smpdl3a	T	C	10: 57,802,437	V112A	probably damaging	Het
Strada	T	A	11: 106,164,907	I305F	probably damaging	Het
Svep1	C	T	4: 58,049,146	E3454K	possibly damaging	Het
Tfap2a	T	A	13: 40,728,754	N25I	probably damaging	Het
Tmem259	T	C	10: 79,977,588	D519G	possibly damaging	Het
Tns1	T	C	1: 73,919,707	Q445R	probably damaging	Het
Topbp1	A	G	9: 103,343,692	D20G	possibly damaging	Het
Trbv5	G	T	6: 41,062,617	W52L	probably damaging	Het
Trpc6	A	T	9: 8,634,057	H379L	probably damaging	Het
Tulp1	T	C	17: 28,362,902	K193E	probably damaging	Het
Unc80	T	C	1: 66,651,543	V2459A	probably benign	Het
Vps50	T	C	6: 3,592,560	V731A	probably benign	Het

Other mutations in Atp4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Atp4a	APN	7	30713204	missense	possibly damaging	0.95
IGL01327:Atp4a	APN	7	30713250	missense	possibly damaging	0.96
IGL01510:Atp4a	APN	7	30720791	missense	probably benign	0.02
IGL01763:Atp4a	APN	7	30715518	missense	probably benign	0.20
IGL02061:Atp4a	APN	7	30715029	missense	probably damaging	1.00
IGL02435:Atp4a	APN	7	30717057	missense	probably benign
IGL02903:Atp4a	APN	7	30715919	missense	probably benign	0.00
IGL03181:Atp4a	APN	7	30724704	missense	probably benign	0.02
IGL03350:Atp4a	APN	7	30720867	missense	probably damaging	1.00
atypical	UTSW	7	30715356	missense	possibly damaging	0.84
sublytic	UTSW	7	30715800	missense	probably benign	0.32
IGL03097:Atp4a	UTSW	7	30723037	missense	probably benign	0.14
R0095:Atp4a	UTSW	7	30720735	missense	probably damaging	0.99
R0121:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0140:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0241:Atp4a	UTSW	7	30717135	missense	probably benign	0.00
R0437:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0624:Atp4a	UTSW	7	30718999	missense	probably benign
R1164:Atp4a	UTSW	7	30717692	missense	probably benign	0.00
R2105:Atp4a	UTSW	7	30720368	critical splice donor site	probably null
R2272:Atp4a	UTSW	7	30715500	nonsense	probably null
R2327:Atp4a	UTSW	7	30720241	missense	probably benign	0.16
R2881:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2990:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2992:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2993:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3123:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3125:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3441:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3442:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3686:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3687:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3845:Atp4a	UTSW	7	30717115	missense	probably null	0.99
R4027:Atp4a	UTSW	7	30724952	splice site	probably null
R4072:Atp4a	UTSW	7	30715332	missense	probably benign	0.09
R4433:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4454:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4457:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4458:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4510:Atp4a	UTSW	7	30724253	nonsense	probably null
R4511:Atp4a	UTSW	7	30724253	nonsense	probably null
R4576:Atp4a	UTSW	7	30717722	missense	probably benign	0.25
R4656:Atp4a	UTSW	7	30719948	intron	probably benign
R4661:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4662:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4852:Atp4a	UTSW	7	30724268	missense	probably benign	0.10
R4892:Atp4a	UTSW	7	30712474	missense	probably benign	0.07
R4907:Atp4a	UTSW	7	30719092	missense	possibly damaging	0.66
R5024:Atp4a	UTSW	7	30715864	missense	possibly damaging	0.82
R5254:Atp4a	UTSW	7	30715530	missense	probably damaging	1.00
R5318:Atp4a	UTSW	7	30715329	missense	probably damaging	1.00
R5340:Atp4a	UTSW	7	30720806	missense	probably benign
R5484:Atp4a	UTSW	7	30720672	unclassified	probably benign
R5729:Atp4a	UTSW	7	30712426	missense	possibly damaging	0.48
R5762:Atp4a	UTSW	7	30719096	missense	probably damaging	0.99
R5797:Atp4a	UTSW	7	30712649	missense	probably damaging	1.00
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6077:Atp4a	UTSW	7	30715919	missense	probably benign	0.00
R6243:Atp4a	UTSW	7	30715957	missense	possibly damaging	0.68
R6346:Atp4a	UTSW	7	30715356	missense	possibly damaging	0.84
R6459:Atp4a	UTSW	7	30712462	missense	probably benign	0.00
R6515:Atp4a	UTSW	7	30712478	missense	possibly damaging	0.78
R6854:Atp4a	UTSW	7	30715008	missense	probably benign	0.29
R7215:Atp4a	UTSW	7	30717360	missense	possibly damaging	0.61
R7271:Atp4a	UTSW	7	30722519	missense	probably benign	0.16
R7340:Atp4a	UTSW	7	30716730	missense	possibly damaging	0.94
R7457:Atp4a	UTSW	7	30720767	missense	probably benign	0.08
R7593:Atp4a	UTSW	7	30724680	missense	probably benign	0.08
R7712:Atp4a	UTSW	7	30715553	missense	probably damaging	0.96
R7762:Atp4a	UTSW	7	30720036	missense	probably damaging	0.96
R8714:Atp4a	UTSW	7	30720588	missense	probably damaging	0.99
R9324:Atp4a	UTSW	7	30715782	missense	probably benign	0.02
Z1177:Atp4a	UTSW	7	30717840	missense	possibly damaging	0.47
Z1186:Atp4a	UTSW	7	30717357	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GATTGATGGCTTCCATGTCCC -3'
(R):5'- TCTGTGTGGCTTCAGGACAG -3'

Sequencing Primer
(F):5'- ATGTCCCCTGCAAAGGCTC -3'
(R):5'- TTCAGGACAGGCTAACGATGCTTC -3'

Posted On

2018-08-29