Incidental Mutation 'R6773:Atp4a'
ID 532242
Institutional Source Beutler Lab
Gene Symbol Atp4a
Ensembl Gene ENSMUSG00000005553
Gene Name ATPase, H+/K+ exchanging, gastric, alpha polypeptide
Synonyms H+K+-transporting alpha 1, H+/K+-ATPase alpha
MMRRC Submission 044889-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R6773 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 30411634-30424959 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30414802 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 197 (V197A)
Ref Sequence ENSEMBL: ENSMUSP00000131964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000005692
AA Change: V197A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: V197A

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 5.4e-23 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 144 375 1.1e-57 PFAM
Pfam:Hydrolase 380 739 5.3e-16 PFAM
Pfam:HAD 383 736 1.9e-18 PFAM
Pfam:Cation_ATPase 436 531 1.6e-24 PFAM
Pfam:Cation_ATPase_C 809 1019 4.8e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170371
AA Change: V197A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: V197A

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 4.9e-28 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 145 376 1e-62 PFAM
Pfam:Hydrolase 380 730 9.3e-25 PFAM
Pfam:HAD 383 727 2.1e-15 PFAM
Pfam:Hydrolase_like2 436 531 4e-25 PFAM
Pfam:Cation_ATPase_C 800 1010 1.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171014
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrm1b T A 3: 92,336,556 (GRCm39) I49F probably damaging Het
Aqp6 A G 15: 99,500,558 (GRCm39) D161G probably damaging Het
Aqr A T 2: 113,979,477 (GRCm39) N319K possibly damaging Het
Asns C A 6: 7,676,284 (GRCm39) R424L probably benign Het
Ccdc70 A G 8: 22,463,321 (GRCm39) E37G probably damaging Het
Ccdc88b A T 19: 6,826,409 (GRCm39) V1102E possibly damaging Het
Cd82 G A 2: 93,252,221 (GRCm39) A130V probably benign Het
Cfap46 T C 7: 139,222,477 (GRCm39) probably benign Het
Cnot6l A C 5: 96,242,158 (GRCm39) C188W probably damaging Het
Cxcr6 A T 9: 123,639,355 (GRCm39) T119S possibly damaging Het
Dok7 G A 5: 35,234,528 (GRCm39) R193H probably damaging Het
Dpy19l1 A T 9: 24,352,068 (GRCm39) S386T probably damaging Het
Frem3 A C 8: 81,338,444 (GRCm39) T246P probably damaging Het
Gm29666 A T 15: 84,798,360 (GRCm39) I67K unknown Het
Gpr153 T A 4: 152,363,757 (GRCm39) V59E probably damaging Het
Inpp4b G A 8: 82,583,249 (GRCm39) probably benign Het
Kcnj13 T C 1: 87,314,482 (GRCm39) I247V possibly damaging Het
Klri1 C T 6: 129,680,510 (GRCm39) V91M possibly damaging Het
M1ap T A 6: 82,945,061 (GRCm39) D118E probably damaging Het
Map4 T C 9: 109,863,993 (GRCm39) V406A probably benign Het
Nedd4l T C 18: 65,300,622 (GRCm39) V369A probably benign Het
Or5ac24 A T 16: 59,165,579 (GRCm39) L162I probably damaging Het
Otud4 A G 8: 80,370,435 (GRCm39) Y71C possibly damaging Het
Plcl1 A G 1: 55,790,461 (GRCm39) N1044D probably benign Het
Ppp4r3b T A 11: 29,155,639 (GRCm39) M114K probably benign Het
Prune1 T C 3: 95,171,082 (GRCm39) D114G probably damaging Het
Rad54l2 A T 9: 106,570,516 (GRCm39) V1268D probably benign Het
Rbbp6 A G 7: 122,598,578 (GRCm39) probably benign Het
Rimbp3 A T 16: 17,026,879 (GRCm39) E101V probably damaging Het
Rit1 C T 3: 88,633,676 (GRCm39) probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,229,114 (GRCm39) probably benign Homo
Shisa9 A G 16: 11,802,892 (GRCm39) T150A probably damaging Het
Smpdl3a T C 10: 57,678,533 (GRCm39) V112A probably damaging Het
Strada T A 11: 106,055,733 (GRCm39) I305F probably damaging Het
Svep1 C T 4: 58,049,146 (GRCm39) E3454K possibly damaging Het
Tfap2a T A 13: 40,882,230 (GRCm39) N25I probably damaging Het
Tmem259 T C 10: 79,813,422 (GRCm39) D519G possibly damaging Het
Tns1 T C 1: 73,958,866 (GRCm39) Q445R probably damaging Het
Topbp1 A G 9: 103,220,891 (GRCm39) D20G possibly damaging Het
Trbv5 G T 6: 41,039,551 (GRCm39) W52L probably damaging Het
Trpc6 A T 9: 8,634,058 (GRCm39) H379L probably damaging Het
Tulp1 T C 17: 28,581,876 (GRCm39) K193E probably damaging Het
Unc80 T C 1: 66,690,702 (GRCm39) V2459A probably benign Het
Vps50 T C 6: 3,592,560 (GRCm39) V731A probably benign Het
Other mutations in Atp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Atp4a APN 7 30,412,629 (GRCm39) missense possibly damaging 0.95
IGL01327:Atp4a APN 7 30,412,675 (GRCm39) missense possibly damaging 0.96
IGL01510:Atp4a APN 7 30,420,216 (GRCm39) missense probably benign 0.02
IGL01763:Atp4a APN 7 30,414,943 (GRCm39) missense probably benign 0.20
IGL02061:Atp4a APN 7 30,414,454 (GRCm39) missense probably damaging 1.00
IGL02435:Atp4a APN 7 30,416,482 (GRCm39) missense probably benign
IGL02903:Atp4a APN 7 30,415,344 (GRCm39) missense probably benign 0.00
IGL03181:Atp4a APN 7 30,424,129 (GRCm39) missense probably benign 0.02
IGL03350:Atp4a APN 7 30,420,292 (GRCm39) missense probably damaging 1.00
atypical UTSW 7 30,414,781 (GRCm39) missense possibly damaging 0.84
sublytic UTSW 7 30,415,225 (GRCm39) missense probably benign 0.32
IGL03097:Atp4a UTSW 7 30,422,462 (GRCm39) missense probably benign 0.14
R0095:Atp4a UTSW 7 30,420,160 (GRCm39) missense probably damaging 0.99
R0121:Atp4a UTSW 7 30,419,526 (GRCm39) missense probably benign 0.00
R0140:Atp4a UTSW 7 30,419,526 (GRCm39) missense probably benign 0.00
R0241:Atp4a UTSW 7 30,416,560 (GRCm39) missense probably benign 0.00
R0437:Atp4a UTSW 7 30,419,526 (GRCm39) missense probably benign 0.00
R0624:Atp4a UTSW 7 30,418,424 (GRCm39) missense probably benign
R1164:Atp4a UTSW 7 30,417,117 (GRCm39) missense probably benign 0.00
R2105:Atp4a UTSW 7 30,419,793 (GRCm39) critical splice donor site probably null
R2272:Atp4a UTSW 7 30,414,925 (GRCm39) nonsense probably null
R2327:Atp4a UTSW 7 30,419,666 (GRCm39) missense probably benign 0.16
R2881:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R2990:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R2992:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R2993:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3123:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3125:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3441:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3442:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3686:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3687:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3845:Atp4a UTSW 7 30,416,540 (GRCm39) missense probably null 0.99
R4027:Atp4a UTSW 7 30,424,377 (GRCm39) splice site probably null
R4072:Atp4a UTSW 7 30,414,757 (GRCm39) missense probably benign 0.09
R4433:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4454:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4457:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4458:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4510:Atp4a UTSW 7 30,423,678 (GRCm39) nonsense probably null
R4511:Atp4a UTSW 7 30,423,678 (GRCm39) nonsense probably null
R4576:Atp4a UTSW 7 30,417,147 (GRCm39) missense probably benign 0.25
R4656:Atp4a UTSW 7 30,419,373 (GRCm39) intron probably benign
R4661:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4662:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4852:Atp4a UTSW 7 30,423,693 (GRCm39) missense probably benign 0.10
R4892:Atp4a UTSW 7 30,411,899 (GRCm39) missense probably benign 0.07
R4907:Atp4a UTSW 7 30,418,517 (GRCm39) missense possibly damaging 0.66
R5024:Atp4a UTSW 7 30,415,289 (GRCm39) missense possibly damaging 0.82
R5254:Atp4a UTSW 7 30,414,955 (GRCm39) missense probably damaging 1.00
R5318:Atp4a UTSW 7 30,414,754 (GRCm39) missense probably damaging 1.00
R5340:Atp4a UTSW 7 30,420,231 (GRCm39) missense probably benign
R5484:Atp4a UTSW 7 30,420,097 (GRCm39) unclassified probably benign
R5729:Atp4a UTSW 7 30,411,851 (GRCm39) missense possibly damaging 0.48
R5762:Atp4a UTSW 7 30,418,521 (GRCm39) missense probably damaging 0.99
R5797:Atp4a UTSW 7 30,412,074 (GRCm39) missense probably damaging 1.00
R6030:Atp4a UTSW 7 30,421,941 (GRCm39) missense probably damaging 0.99
R6030:Atp4a UTSW 7 30,421,941 (GRCm39) missense probably damaging 0.99
R6077:Atp4a UTSW 7 30,415,344 (GRCm39) missense probably benign 0.00
R6243:Atp4a UTSW 7 30,415,382 (GRCm39) missense possibly damaging 0.68
R6346:Atp4a UTSW 7 30,414,781 (GRCm39) missense possibly damaging 0.84
R6459:Atp4a UTSW 7 30,411,887 (GRCm39) missense probably benign 0.00
R6515:Atp4a UTSW 7 30,411,903 (GRCm39) missense possibly damaging 0.78
R6854:Atp4a UTSW 7 30,414,433 (GRCm39) missense probably benign 0.29
R7215:Atp4a UTSW 7 30,416,785 (GRCm39) missense possibly damaging 0.61
R7271:Atp4a UTSW 7 30,421,944 (GRCm39) missense probably benign 0.16
R7340:Atp4a UTSW 7 30,416,155 (GRCm39) missense possibly damaging 0.94
R7457:Atp4a UTSW 7 30,420,192 (GRCm39) missense probably benign 0.08
R7593:Atp4a UTSW 7 30,424,105 (GRCm39) missense probably benign 0.08
R7712:Atp4a UTSW 7 30,414,978 (GRCm39) missense probably damaging 0.96
R7762:Atp4a UTSW 7 30,419,461 (GRCm39) missense probably damaging 0.96
R8714:Atp4a UTSW 7 30,420,013 (GRCm39) missense probably damaging 0.99
R9324:Atp4a UTSW 7 30,415,207 (GRCm39) missense probably benign 0.02
Z1177:Atp4a UTSW 7 30,417,265 (GRCm39) missense possibly damaging 0.47
Z1186:Atp4a UTSW 7 30,416,782 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GATTGATGGCTTCCATGTCCC -3'
(R):5'- TCTGTGTGGCTTCAGGACAG -3'

Sequencing Primer
(F):5'- ATGTCCCCTGCAAAGGCTC -3'
(R):5'- TTCAGGACAGGCTAACGATGCTTC -3'
Posted On 2018-08-29