Mutagenetix > Incidental Mutation

Incidental Mutation 'R6773:Cfap46'

532245

Institutional Source

Beutler Lab

Gene Symbol

Cfap46

Ensembl Gene

ENSMUSG00000049571

Gene Name

cilia and flagella associated protein 46

Synonyms

9330101J02Rik

MMRRC Submission

044889-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6773 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

139600951-139683817 bp(-) (GRCm38)

Type of Mutation

utr 3 prime

DNA Base Change (assembly)

T to C at 139642561 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000120463 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000140820] [ENSMUST00000155075]

AlphaFold

E9Q2C0

Predicted Effect

unknown
Transcript: ENSMUST00000129990
AA Change: T1167A

SMART Domains

Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: T1167A

Domain	Start	End	E-Value	Type
Blast:TPR	175	207	7e-11	BLAST
Blast:TPR	426	459	1e-11	BLAST
low complexity region	868	879	N/A	INTRINSIC
Blast:TPR	936	969	2e-7	BLAST
Blast:TPR	1112	1145	1e-9	BLAST
coiled coil region	1347	1423	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140820

SMART Domains

Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571

Domain	Start	End	E-Value	Type
Blast:TPR	175	208	5e-11	BLAST
Blast:TPR	426	459	8e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000155075

Meta Mutation Damage Score

0.1025

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 96.8%

Validation Efficiency

98% (44/45)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aqp6	A	G	15: 99,602,677	D161G	probably damaging	Het
Aqr	A	T	2: 114,148,996	N319K	possibly damaging	Het
Asns	C	A	6: 7,676,284	R424L	probably benign	Het
Atp4a	T	C	7: 30,715,377	V197A	probably damaging	Het
Ccdc70	A	G	8: 21,973,305	E37G	probably damaging	Het
Ccdc88b	A	T	19: 6,849,041	V1102E	possibly damaging	Het
Cd82	G	A	2: 93,421,876	A130V	probably benign	Het
Cnot6l	A	C	5: 96,094,299	C188W	probably damaging	Het
Cxcr6	A	T	9: 123,810,290	T119S	possibly damaging	Het
Dok7	G	A	5: 35,077,184	R193H	probably damaging	Het
Dpy19l1	A	T	9: 24,440,772	S386T	probably damaging	Het
Frem3	A	C	8: 80,611,815	T246P	probably damaging	Het
Gm29666	A	T	15: 84,914,159	I67K	unknown	Het
Gm9774	T	A	3: 92,429,249	I49F	probably damaging	Het
Gpr153	T	A	4: 152,279,300	V59E	probably damaging	Het
Inpp4b	G	A	8: 81,856,620		probably benign	Het
Kcnj13	T	C	1: 87,386,760	I247V	possibly damaging	Het
Klri1	C	T	6: 129,703,547	V91M	possibly damaging	Het
M1ap	T	A	6: 82,968,080	D118E	probably damaging	Het
Map4	T	C	9: 110,034,925	V406A	probably benign	Het
Nedd4l	T	C	18: 65,167,551	V369A	probably benign	Het
Olfr206	A	T	16: 59,345,216	L162I	probably damaging	Het
Otud4	A	G	8: 79,643,806	Y71C	possibly damaging	Het
Plcl1	A	G	1: 55,751,302	N1044D	probably benign	Het
Ppp4r3b	T	A	11: 29,205,639	M114K	probably benign	Het
Prune1	T	C	3: 95,263,771	D114G	probably damaging	Het
Rad54l2	A	T	9: 106,693,317	V1268D	probably benign	Het
Rbbp6	A	G	7: 122,999,355		probably benign	Het
Rimbp3	A	T	16: 17,209,015	E101V	probably damaging	Het
Rit1	C	T	3: 88,726,369		probably null	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Homo
Shisa9	A	G	16: 11,985,028	T150A	probably damaging	Het
Smpdl3a	T	C	10: 57,802,437	V112A	probably damaging	Het
Strada	T	A	11: 106,164,907	I305F	probably damaging	Het
Svep1	C	T	4: 58,049,146	E3454K	possibly damaging	Het
Tfap2a	T	A	13: 40,728,754	N25I	probably damaging	Het
Tmem259	T	C	10: 79,977,588	D519G	possibly damaging	Het
Tns1	T	C	1: 73,919,707	Q445R	probably damaging	Het
Topbp1	A	G	9: 103,343,692	D20G	possibly damaging	Het
Trbv5	G	T	6: 41,062,617	W52L	probably damaging	Het
Trpc6	A	T	9: 8,634,057	H379L	probably damaging	Het
Tulp1	T	C	17: 28,362,902	K193E	probably damaging	Het
Unc80	T	C	1: 66,651,543	V2459A	probably benign	Het
Vps50	T	C	6: 3,592,560	V731A	probably benign	Het

Other mutations in Cfap46

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL00493:Cfap46	APN	7	139614443	missense	probably benign	0.06
IGL00505:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL00508:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL00514:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL01394:Cfap46	APN	7	139666979	missense	probably damaging	1.00
IGL01621:Cfap46	APN	7	139606607	missense	unknown
IGL02171:Cfap46	APN	7	139667056	missense	possibly damaging	0.86
IGL02343:Cfap46	APN	7	139682509	missense	probably damaging	0.99
IGL02679:Cfap46	APN	7	139614470	missense	probably damaging	0.99
IGL02687:Cfap46	APN	7	139607201	missense	probably damaging	0.99
IGL03180:Cfap46	APN	7	139603252	missense	unknown
IGL03329:Cfap46	APN	7	139601165	missense	probably damaging	0.99
FR4449:Cfap46	UTSW	7	139638795	utr 3 prime	probably benign
FR4737:Cfap46	UTSW	7	139638930	utr 3 prime	probably benign
FR4976:Cfap46	UTSW	7	139638930	utr 3 prime	probably benign
PIT4651001:Cfap46	UTSW	7	139645551	missense
R0051:Cfap46	UTSW	7	139676035	missense	probably damaging	1.00
R0051:Cfap46	UTSW	7	139676035	missense	probably damaging	1.00
R0318:Cfap46	UTSW	7	139654566	missense	probably damaging	1.00
R0358:Cfap46	UTSW	7	139651533	splice site	probably benign
R0650:Cfap46	UTSW	7	139605655	missense	unknown
R0675:Cfap46	UTSW	7	139676034	missense	probably damaging	1.00
R0750:Cfap46	UTSW	7	139654670	missense	probably damaging	1.00
R0931:Cfap46	UTSW	7	139655841	missense	probably damaging	1.00
R1024:Cfap46	UTSW	7	139642597	missense	probably benign	0.42
R1251:Cfap46	UTSW	7	139601265	missense	probably benign	0.40
R1257:Cfap46	UTSW	7	139654629	nonsense	probably null
R1538:Cfap46	UTSW	7	139683008	missense	probably null	1.00
R1618:Cfap46	UTSW	7	139652810	missense	probably benign	0.04
R1655:Cfap46	UTSW	7	139642520	nonsense	probably null
R1824:Cfap46	UTSW	7	139639602	missense	probably benign	0.12
R1830:Cfap46	UTSW	7	139640407	missense	possibly damaging	0.92
R1857:Cfap46	UTSW	7	139653408	missense	probably damaging	1.00
R1870:Cfap46	UTSW	7	139683470	missense	probably damaging	1.00
R1945:Cfap46	UTSW	7	139679903	missense	probably damaging	1.00
R1962:Cfap46	UTSW	7	139667041	missense	probably damaging	1.00
R2108:Cfap46	UTSW	7	139683761	missense	probably benign	0.03
R2354:Cfap46	UTSW	7	139661046	missense	probably damaging	0.99
R2367:Cfap46	UTSW	7	139653498	missense	probably damaging	0.99
R3237:Cfap46	UTSW	7	139617590	missense	probably damaging	1.00
R3617:Cfap46	UTSW	7	139639599	missense	probably benign	0.06
R3949:Cfap46	UTSW	7	139678551	missense	probably benign	0.12
R4239:Cfap46	UTSW	7	139666287	missense	possibly damaging	0.74
R4240:Cfap46	UTSW	7	139666287	missense	possibly damaging	0.74
R4297:Cfap46	UTSW	7	139652673	missense	probably benign	0.27
R4365:Cfap46	UTSW	7	139650952	missense	probably damaging	0.99
R4516:Cfap46	UTSW	7	139660082	intron	probably benign
R4595:Cfap46	UTSW	7	139652404	missense	possibly damaging	0.74
R4627:Cfap46	UTSW	7	139657281	missense	probably damaging	0.99
R4627:Cfap46	UTSW	7	139680927	missense	probably damaging	1.00
R4628:Cfap46	UTSW	7	139680927	missense	probably damaging	1.00
R4629:Cfap46	UTSW	7	139680927	missense	probably damaging	1.00
R4687:Cfap46	UTSW	7	139627456	missense	possibly damaging	0.79
R4750:Cfap46	UTSW	7	139679323	critical splice donor site	probably null
R4771:Cfap46	UTSW	7	139630608	missense	probably null
R4779:Cfap46	UTSW	7	139659815	intron	probably benign
R4812:Cfap46	UTSW	7	139636000	missense	probably damaging	1.00
R4974:Cfap46	UTSW	7	139607188	critical splice donor site	probably null
R5014:Cfap46	UTSW	7	139627375	missense	probably benign	0.12
R5033:Cfap46	UTSW	7	139603860	missense	probably benign	0.00
R5055:Cfap46	UTSW	7	139661190	missense	probably damaging	1.00
R5254:Cfap46	UTSW	7	139678514	missense	possibly damaging	0.77
R5288:Cfap46	UTSW	7	139613507	critical splice donor site	probably null
R5366:Cfap46	UTSW	7	139650886	missense	probably damaging	1.00
R5368:Cfap46	UTSW	7	139627473	missense	possibly damaging	0.77
R5371:Cfap46	UTSW	7	139632181	splice site	probably null
R5642:Cfap46	UTSW	7	139678577	missense	probably damaging	1.00
R5690:Cfap46	UTSW	7	139638353	missense	probably benign	0.01
R5691:Cfap46	UTSW	7	139606700	missense	possibly damaging	0.49
R5696:Cfap46	UTSW	7	139612031	missense	probably damaging	1.00
R5844:Cfap46	UTSW	7	139650942	missense	probably damaging	0.99
R5963:Cfap46	UTSW	7	139651595	missense	probably damaging	0.97
R6217:Cfap46	UTSW	7	139638900	utr 3 prime	probably benign
R6228:Cfap46	UTSW	7	139656580	missense	probably damaging	1.00
R6251:Cfap46	UTSW	7	139638900	utr 3 prime	probably benign
R6253:Cfap46	UTSW	7	139638900	utr 3 prime	probably benign
R6285:Cfap46	UTSW	7	139661085	missense	probably damaging	1.00
R6334:Cfap46	UTSW	7	139680831	missense	probably damaging	1.00
R6520:Cfap46	UTSW	7	139614405	critical splice donor site	probably null
R6736:Cfap46	UTSW	7	139619971	missense	possibly damaging	0.92
R6760:Cfap46	UTSW	7	139652440	missense	probably damaging	1.00
R6835:Cfap46	UTSW	7	139652498	missense	probably damaging	0.98
R6903:Cfap46	UTSW	7	139654561	critical splice donor site	probably null
R6912:Cfap46	UTSW	7	139639700	missense	probably benign	0.09
R7163:Cfap46	UTSW	7	139618078	critical splice donor site	probably null
R7232:Cfap46	UTSW	7	139617577	missense	unknown
R7327:Cfap46	UTSW	7	139635146	splice site	probably null
R7336:Cfap46	UTSW	7	139620104	missense	unknown
R7337:Cfap46	UTSW	7	139630576	critical splice donor site	probably null
R7437:Cfap46	UTSW	7	139650837	nonsense	probably null
R7450:Cfap46	UTSW	7	139617437	missense	unknown
R7495:Cfap46	UTSW	7	139603196	critical splice donor site	probably null
R7618:Cfap46	UTSW	7	139603239	missense
R7623:Cfap46	UTSW	7	139618350	missense	unknown
R7765:Cfap46	UTSW	7	139651564	missense
R7971:Cfap46	UTSW	7	139635127	missense	unknown
R8211:Cfap46	UTSW	7	139633304	missense	unknown
R8306:Cfap46	UTSW	7	139656580	missense
R8354:Cfap46	UTSW	7	139653498	missense	probably benign	0.03
R8365:Cfap46	UTSW	7	139683084	nonsense	probably null
R8447:Cfap46	UTSW	7	139680986	missense	possibly damaging	0.90
R8715:Cfap46	UTSW	7	139605644	missense
R8805:Cfap46	UTSW	7	139632063	missense	unknown
R8830:Cfap46	UTSW	7	139615649	missense	unknown
R8912:Cfap46	UTSW	7	139680181	intron	probably benign
R8920:Cfap46	UTSW	7	139652526	missense
R8977:Cfap46	UTSW	7	139679933	missense	probably benign	0.01
R9048:Cfap46	UTSW	7	139627343	missense	unknown
R9224:Cfap46	UTSW	7	139678500	nonsense	probably null
R9243:Cfap46	UTSW	7	139615349	intron	probably benign
R9252:Cfap46	UTSW	7	139618249	missense	unknown
R9276:Cfap46	UTSW	7	139621291	missense	unknown
R9301:Cfap46	UTSW	7	139642545	missense
R9391:Cfap46	UTSW	7	139618111	missense	unknown
R9402:Cfap46	UTSW	7	139635949	missense	unknown
R9443:Cfap46	UTSW	7	139615107	missense
R9564:Cfap46	UTSW	7	139651555	missense
R9625:Cfap46	UTSW	7	139650889	missense
R9626:Cfap46	UTSW	7	139650889	missense
R9638:Cfap46	UTSW	7	139629847	missense	unknown
R9656:Cfap46	UTSW	7	139655900	missense
R9658:Cfap46	UTSW	7	139666313	missense
R9747:Cfap46	UTSW	7	139611991	missense	unknown
RF023:Cfap46	UTSW	7	139638918
W0251:Cfap46	UTSW	7	139603946	missense	probably benign	0.11
X0018:Cfap46	UTSW	7	139680912	missense	probably benign	0.03
X0064:Cfap46	UTSW	7	139603447	missense	probably benign	0.01
Z1088:Cfap46	UTSW	7	139635064	missense	probably damaging	0.96
Z1176:Cfap46	UTSW	7	139639548	missense
Z1177:Cfap46	UTSW	7	139601267	missense	unknown
Z1177:Cfap46	UTSW	7	139630626	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGTGACATCCTCTGAGCTGAC -3'
(R):5'- CCGCTGTACCTTTCCACTAAAG -3'

Sequencing Primer
(F):5'- TCTGAGCTGACCCACGAAG -3'
(R):5'- AGGACTTCACCACATATAGAGC -3'

Posted On

2018-08-29