Mutagenetix > Incidental Mutations

Incidental Mutation 'R6773:Cfap46'

532245

Institutional Source

Beutler Lab

Gene Symbol

Cfap46

Ensembl Gene

ENSMUSG00000049571

Gene Name

cilia and flagella associated protein 46

Synonyms

9330101J02Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6773 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

139600951-139683817 bp(-) (GRCm38)

Type of Mutation

utr 3 prime

DNA Base Change (assembly)

T to C at 139642561 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000120463 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000140820] [ENSMUST00000155075]

AlphaFold

E9Q2C0

Predicted Effect

unknown
Transcript: ENSMUST00000129990
AA Change: T1167A

SMART Domains

Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: T1167A

Domain	Start	End	E-Value	Type
Blast:TPR	175	207	7e-11	BLAST
Blast:TPR	426	459	1e-11	BLAST
low complexity region	868	879	N/A	INTRINSIC
Blast:TPR	936	969	2e-7	BLAST
Blast:TPR	1112	1145	1e-9	BLAST
coiled coil region	1347	1423	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140820

SMART Domains

Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571

Domain	Start	End	E-Value	Type
Blast:TPR	175	208	5e-11	BLAST
Blast:TPR	426	459	8e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000155075

Meta Mutation Damage Score

0.1025

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 96.8%

Validation Efficiency

98% (44/45)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aqp6	A	G	15: 99,602,677	D161G	probably damaging	Het
Aqr	A	T	2: 114,148,996	N319K	possibly damaging	Het
Asns	C	A	6: 7,676,284	R424L	probably benign	Het
Atp4a	T	C	7: 30,715,377	V197A	probably damaging	Het
Ccdc70	A	G	8: 21,973,305	E37G	probably damaging	Het
Ccdc88b	A	T	19: 6,849,041	V1102E	possibly damaging	Het
Cd82	G	A	2: 93,421,876	A130V	probably benign	Het
Cnot6l	A	C	5: 96,094,299	C188W	probably damaging	Het
Cxcr6	A	T	9: 123,810,290	T119S	possibly damaging	Het
Dok7	G	A	5: 35,077,184	R193H	probably damaging	Het
Dpy19l1	A	T	9: 24,440,772	S386T	probably damaging	Het
Frem3	A	C	8: 80,611,815	T246P	probably damaging	Het
Gm29666	A	T	15: 84,914,159	I67K	unknown	Het
Gm9774	T	A	3: 92,429,249	I49F	probably damaging	Het
Gpr153	T	A	4: 152,279,300	V59E	probably damaging	Het
Inpp4b	G	A	8: 81,856,620		probably benign	Het
Kcnj13	T	C	1: 87,386,760	I247V	possibly damaging	Het
Klri1	C	T	6: 129,703,547	V91M	possibly damaging	Het
M1ap	T	A	6: 82,968,080	D118E	probably damaging	Het
Map4	T	C	9: 110,034,925	V406A	probably benign	Het
Nedd4l	T	C	18: 65,167,551	V369A	probably benign	Het
Olfr206	A	T	16: 59,345,216	L162I	probably damaging	Het
Otud4	A	G	8: 79,643,806	Y71C	possibly damaging	Het
Plcl1	A	G	1: 55,751,302	N1044D	probably benign	Het
Ppp4r3b	T	A	11: 29,205,639	M114K	probably benign	Het
Prune1	T	C	3: 95,263,771	D114G	probably damaging	Het
Rad54l2	A	T	9: 106,693,317	V1268D	probably benign	Het
Rbbp6	A	G	7: 122,999,355		probably benign	Het
Rimbp3	A	T	16: 17,209,015	E101V	probably damaging	Het
Rit1	C	T	3: 88,726,369		probably null	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Homo
Shisa9	A	G	16: 11,985,028	T150A	probably damaging	Het
Smpdl3a	T	C	10: 57,802,437	V112A	probably damaging	Het
Strada	T	A	11: 106,164,907	I305F	probably damaging	Het
Svep1	C	T	4: 58,049,146	E3454K	possibly damaging	Het
Tfap2a	T	A	13: 40,728,754	N25I	probably damaging	Het
Tmem259	T	C	10: 79,977,588	D519G	possibly damaging	Het
Tns1	T	C	1: 73,919,707	Q445R	probably damaging	Het
Topbp1	A	G	9: 103,343,692	D20G	possibly damaging	Het
Trbv5	G	T	6: 41,062,617	W52L	probably damaging	Het
Trpc6	A	T	9: 8,634,057	H379L	probably damaging	Het
Tulp1	T	C	17: 28,362,902	K193E	probably damaging	Het
Unc80	T	C	1: 66,651,543	V2459A	probably benign	Het
Vps50	T	C	6: 3,592,560	V731A	probably benign	Het

Other mutations in Cfap46

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL00493:Cfap46	APN	7	139614443	missense	probably benign	0.06
IGL00505:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL00508:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL00514:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL01394:Cfap46	APN	7	139666979	missense	probably damaging	1.00
IGL01621:Cfap46	APN	7	139606607	missense	unknown
IGL02171:Cfap46	APN	7	139667056	missense	possibly damaging	0.86
IGL02343:Cfap46	APN	7	139682509	missense	probably damaging	0.99
IGL02679:Cfap46	APN	7	139614470	missense	probably damaging	0.99
IGL02687:Cfap46	APN	7	139607201	missense	probably damaging	0.99
IGL03180:Cfap46	APN	7	139603252	missense	unknown
IGL03329:Cfap46	APN	7	139601165	missense	probably damaging	0.99
FR4449:Cfap46	UTSW	7	139638795	utr 3 prime	probably benign
FR4737:Cfap46	UTSW	7	139638930	utr 3 prime	probably benign
FR4976:Cfap46	UTSW	7	139638930	utr 3 prime	probably benign
PIT4651001:Cfap46	UTSW	7	139645551	missense
R0051:Cfap46	UTSW	7	139676035	missense	probably damaging	1.00
R0051:Cfap46	UTSW	7	139676035	missense	probably damaging	1.00
R0318:Cfap46	UTSW	7	139654566	missense	probably damaging	1.00
R0358:Cfap46	UTSW	7	139651533	splice site	probably benign
R0650:Cfap46	UTSW	7	139605655	missense	unknown
R0675:Cfap46	UTSW	7	139676034	missense	probably damaging	1.00
R0750:Cfap46	UTSW	7	139654670	missense	probably damaging	1.00
R0931:Cfap46	UTSW	7	139655841	missense	probably damaging	1.00
R1024:Cfap46	UTSW	7	139642597	missense	probably benign	0.42
R1251:Cfap46	UTSW	7	139601265	missense	probably benign	0.40
R1257:Cfap46	UTSW	7	139654629	nonsense	probably null
R1538:Cfap46	UTSW	7	139683008	missense	probably null	1.00
R1618:Cfap46	UTSW	7	139652810	missense	probably benign	0.04
R1655:Cfap46	UTSW	7	139642520	nonsense	probably null
R1824:Cfap46	UTSW	7	139639602	missense	probably benign	0.12
R1830:Cfap46	UTSW	7	139640407	missense	possibly damaging	0.92
R1857:Cfap46	UTSW	7	139653408	missense	probably damaging	1.00
R1870:Cfap46	UTSW	7	139683470	missense	probably damaging	1.00
R1945:Cfap46	UTSW	7	139679903	missense	probably damaging	1.00
R1962:Cfap46	UTSW	7	139667041	missense	probably damaging	1.00
R2108:Cfap46	UTSW	7	139683761	missense	probably benign	0.03
R2354:Cfap46	UTSW	7	139661046	missense	probably damaging	0.99
R2367:Cfap46	UTSW	7	139653498	missense	probably damaging	0.99
R3237:Cfap46	UTSW	7	139617590	missense	probably damaging	1.00
R3617:Cfap46	UTSW	7	139639599	missense	probably benign	0.06
R3949:Cfap46	UTSW	7	139678551	missense	probably benign	0.12
R4239:Cfap46	UTSW	7	139666287	missense	possibly damaging	0.74
R4240:Cfap46	UTSW	7	139666287	missense	possibly damaging	0.74
R4297:Cfap46	UTSW	7	139652673	missense	probably benign	0.27
R4365:Cfap46	UTSW	7	139650952	missense	probably damaging	0.99
R4516:Cfap46	UTSW	7	139660082	intron	probably benign
R4595:Cfap46	UTSW	7	139652404	missense	possibly damaging	0.74
R4627:Cfap46	UTSW	7	139657281	missense	probably damaging	0.99
R4627:Cfap46	UTSW	7	139680927	missense	probably damaging	1.00
R4628:Cfap46	UTSW	7	139680927	missense	probably damaging	1.00
R4629:Cfap46	UTSW	7	139680927	missense	probably damaging	1.00
R4687:Cfap46	UTSW	7	139627456	missense	possibly damaging	0.79
R4750:Cfap46	UTSW	7	139679323	critical splice donor site	probably null
R4771:Cfap46	UTSW	7	139630608	missense	probably null
R4779:Cfap46	UTSW	7	139659815	intron	probably benign
R4812:Cfap46	UTSW	7	139636000	missense	probably damaging	1.00
R4974:Cfap46	UTSW	7	139607188	critical splice donor site	probably null
R5014:Cfap46	UTSW	7	139627375	missense	probably benign	0.12
R5033:Cfap46	UTSW	7	139603860	missense	probably benign	0.00
R5055:Cfap46	UTSW	7	139661190	missense	probably damaging	1.00
R5254:Cfap46	UTSW	7	139678514	missense	possibly damaging	0.77
R5288:Cfap46	UTSW	7	139613507	critical splice donor site	probably null
R5366:Cfap46	UTSW	7	139650886	missense	probably damaging	1.00
R5368:Cfap46	UTSW	7	139627473	missense	possibly damaging	0.77
R5371:Cfap46	UTSW	7	139632181	splice site	probably null
R5642:Cfap46	UTSW	7	139678577	missense	probably damaging	1.00
R5690:Cfap46	UTSW	7	139638353	missense	probably benign	0.01
R5691:Cfap46	UTSW	7	139606700	missense	possibly damaging	0.49
R5696:Cfap46	UTSW	7	139612031	missense	probably damaging	1.00
R5844:Cfap46	UTSW	7	139650942	missense	probably damaging	0.99
R5963:Cfap46	UTSW	7	139651595	missense	probably damaging	0.97
R6217:Cfap46	UTSW	7	139638900	utr 3 prime	probably benign
R6228:Cfap46	UTSW	7	139656580	missense	probably damaging	1.00
R6251:Cfap46	UTSW	7	139638900	utr 3 prime	probably benign
R6253:Cfap46	UTSW	7	139638900	utr 3 prime	probably benign
R6285:Cfap46	UTSW	7	139661085	missense	probably damaging	1.00
R6334:Cfap46	UTSW	7	139680831	missense	probably damaging	1.00
R6520:Cfap46	UTSW	7	139614405	critical splice donor site	probably null
R6736:Cfap46	UTSW	7	139619971	missense	possibly damaging	0.92
R6760:Cfap46	UTSW	7	139652440	missense	probably damaging	1.00
R6835:Cfap46	UTSW	7	139652498	missense	probably damaging	0.98
R6903:Cfap46	UTSW	7	139654561	critical splice donor site	probably null
R6912:Cfap46	UTSW	7	139639700	missense	probably benign	0.09
R7163:Cfap46	UTSW	7	139618078	critical splice donor site	probably null
R7232:Cfap46	UTSW	7	139617577	missense	unknown
R7327:Cfap46	UTSW	7	139635146	splice site	probably null
R7336:Cfap46	UTSW	7	139620104	missense	unknown
R7337:Cfap46	UTSW	7	139630576	critical splice donor site	probably null
R7437:Cfap46	UTSW	7	139650837	nonsense	probably null
R7450:Cfap46	UTSW	7	139617437	missense	unknown
R7495:Cfap46	UTSW	7	139603196	critical splice donor site	probably null
R7618:Cfap46	UTSW	7	139603239	missense
R7623:Cfap46	UTSW	7	139618350	missense	unknown
R7765:Cfap46	UTSW	7	139651564	missense
R7971:Cfap46	UTSW	7	139635127	missense	unknown
R8211:Cfap46	UTSW	7	139633304	missense	unknown
R8306:Cfap46	UTSW	7	139656580	missense
R8354:Cfap46	UTSW	7	139653498	missense	probably benign	0.03
R8365:Cfap46	UTSW	7	139683084	nonsense	probably null
R8447:Cfap46	UTSW	7	139680986	missense	possibly damaging	0.90
R8715:Cfap46	UTSW	7	139605644	missense
R8805:Cfap46	UTSW	7	139632063	missense	unknown
R8830:Cfap46	UTSW	7	139615649	missense	unknown
R8912:Cfap46	UTSW	7	139680181	intron	probably benign
R8920:Cfap46	UTSW	7	139652526	missense
R8977:Cfap46	UTSW	7	139679933	missense	probably benign	0.01
R9048:Cfap46	UTSW	7	139627343	missense	unknown
R9224:Cfap46	UTSW	7	139678500	nonsense	probably null
R9252:Cfap46	UTSW	7	139618249	missense	unknown
R9276:Cfap46	UTSW	7	139621291	missense	unknown
R9301:Cfap46	UTSW	7	139642545	missense
R9391:Cfap46	UTSW	7	139618111	missense	unknown
R9402:Cfap46	UTSW	7	139635949	missense	unknown
R9443:Cfap46	UTSW	7	139615107	missense
RF023:Cfap46	UTSW	7	139638918
W0251:Cfap46	UTSW	7	139603946	missense	probably benign	0.11
X0018:Cfap46	UTSW	7	139680912	missense	probably benign	0.03
X0064:Cfap46	UTSW	7	139603447	missense	probably benign	0.01
Z1088:Cfap46	UTSW	7	139635064	missense	probably damaging	0.96
Z1176:Cfap46	UTSW	7	139639548	missense
Z1177:Cfap46	UTSW	7	139601267	missense	unknown
Z1177:Cfap46	UTSW	7	139630626	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGTGACATCCTCTGAGCTGAC -3'
(R):5'- CCGCTGTACCTTTCCACTAAAG -3'

Sequencing Primer
(F):5'- TCTGAGCTGACCCACGAAG -3'
(R):5'- AGGACTTCACCACATATAGAGC -3'

Posted On

2018-08-29