Incidental Mutation 'R6773:Frem3'
ID 532248
Institutional Source Beutler Lab
Gene Symbol Frem3
Ensembl Gene ENSMUSG00000042353
Gene Name Fras1 related extracellular matrix protein 3
Synonyms LOC333315
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.165) question?
Stock # R6773 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 80611080-80695356 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 80611815 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 246 (T246P)
Ref Sequence ENSEMBL: ENSMUSP00000038015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039695]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039695
AA Change: T246P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: T246P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Meta Mutation Damage Score 0.2487 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp6 A G 15: 99,602,677 D161G probably damaging Het
Aqr A T 2: 114,148,996 N319K possibly damaging Het
Asns C A 6: 7,676,284 R424L probably benign Het
Atp4a T C 7: 30,715,377 V197A probably damaging Het
Ccdc70 A G 8: 21,973,305 E37G probably damaging Het
Ccdc88b A T 19: 6,849,041 V1102E possibly damaging Het
Cd82 G A 2: 93,421,876 A130V probably benign Het
Cfap46 T C 7: 139,642,561 probably benign Het
Cnot6l A C 5: 96,094,299 C188W probably damaging Het
Cxcr6 A T 9: 123,810,290 T119S possibly damaging Het
Dok7 G A 5: 35,077,184 R193H probably damaging Het
Dpy19l1 A T 9: 24,440,772 S386T probably damaging Het
Gm29666 A T 15: 84,914,159 I67K unknown Het
Gm9774 T A 3: 92,429,249 I49F probably damaging Het
Gpr153 T A 4: 152,279,300 V59E probably damaging Het
Inpp4b G A 8: 81,856,620 probably benign Het
Kcnj13 T C 1: 87,386,760 I247V possibly damaging Het
Klri1 C T 6: 129,703,547 V91M possibly damaging Het
M1ap T A 6: 82,968,080 D118E probably damaging Het
Map4 T C 9: 110,034,925 V406A probably benign Het
Nedd4l T C 18: 65,167,551 V369A probably benign Het
Olfr206 A T 16: 59,345,216 L162I probably damaging Het
Otud4 A G 8: 79,643,806 Y71C possibly damaging Het
Plcl1 A G 1: 55,751,302 N1044D probably benign Het
Ppp4r3b T A 11: 29,205,639 M114K probably benign Het
Prune1 T C 3: 95,263,771 D114G probably damaging Het
Rad54l2 A T 9: 106,693,317 V1268D probably benign Het
Rbbp6 A G 7: 122,999,355 probably benign Het
Rimbp3 A T 16: 17,209,015 E101V probably damaging Het
Rit1 C T 3: 88,726,369 probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Shisa9 A G 16: 11,985,028 T150A probably damaging Het
Smpdl3a T C 10: 57,802,437 V112A probably damaging Het
Strada T A 11: 106,164,907 I305F probably damaging Het
Svep1 C T 4: 58,049,146 E3454K possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tmem259 T C 10: 79,977,588 D519G possibly damaging Het
Tns1 T C 1: 73,919,707 Q445R probably damaging Het
Topbp1 A G 9: 103,343,692 D20G possibly damaging Het
Trbv5 G T 6: 41,062,617 W52L probably damaging Het
Trpc6 A T 9: 8,634,057 H379L probably damaging Het
Tulp1 T C 17: 28,362,902 K193E probably damaging Het
Unc80 T C 1: 66,651,543 V2459A probably benign Het
Vps50 T C 6: 3,592,560 V731A probably benign Het
Other mutations in Frem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Frem3 APN 8 80668810 missense possibly damaging 0.75
IGL01019:Frem3 APN 8 80615134 missense probably benign 0.02
IGL01470:Frem3 APN 8 80614315 missense probably damaging 1.00
IGL01609:Frem3 APN 8 80612704 missense probably benign 0.00
IGL01622:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01623:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01751:Frem3 APN 8 80615743 missense probably benign 0.33
IGL02037:Frem3 APN 8 80611489 missense probably benign 0.31
IGL02039:Frem3 APN 8 80612971 missense probably damaging 1.00
IGL02084:Frem3 APN 8 80612443 missense possibly damaging 0.95
IGL02124:Frem3 APN 8 80613094 missense probably damaging 0.99
IGL02140:Frem3 APN 8 80614107 missense possibly damaging 0.84
IGL02836:Frem3 APN 8 80614381 missense probably benign
IGL03090:Frem3 APN 8 80618229 missense probably benign 0.01
IGL03102:Frem3 APN 8 80613032 missense possibly damaging 0.92
IGL03116:Frem3 APN 8 80612806 missense possibly damaging 0.84
IGL03165:Frem3 APN 8 80612529 missense probably benign 0.26
IGL03224:Frem3 APN 8 80613463 missense probably damaging 1.00
IGL03401:Frem3 APN 8 80614541 missense probably damaging 1.00
IGL03403:Frem3 APN 8 80611090 missense probably benign 0.04
FR4340:Frem3 UTSW 8 80615241 small insertion probably benign
FR4976:Frem3 UTSW 8 80615241 small insertion probably benign
IGL02991:Frem3 UTSW 8 80668882 missense probably damaging 1.00
IGL03052:Frem3 UTSW 8 80614530 missense probably damaging 1.00
R0089:Frem3 UTSW 8 80615878 missense possibly damaging 0.94
R0647:Frem3 UTSW 8 80615185 missense probably damaging 1.00
R0690:Frem3 UTSW 8 80613952 missense possibly damaging 0.84
R0766:Frem3 UTSW 8 80615322 missense probably benign
R0834:Frem3 UTSW 8 80687008 missense probably damaging 1.00
R0909:Frem3 UTSW 8 80663406 missense probably benign 0.45
R1033:Frem3 UTSW 8 80695157 missense probably benign 0.00
R1144:Frem3 UTSW 8 80611884 missense probably benign 0.01
R1312:Frem3 UTSW 8 80615322 missense probably benign
R1330:Frem3 UTSW 8 80668839 missense probably damaging 0.99
R1355:Frem3 UTSW 8 80690702 missense probably damaging 1.00
R1390:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R1413:Frem3 UTSW 8 80668801 missense probably benign
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1503:Frem3 UTSW 8 80687018 missense probably damaging 0.99
R1538:Frem3 UTSW 8 80612710 missense probably damaging 1.00
R1538:Frem3 UTSW 8 80613135 missense probably benign 0.00
R1612:Frem3 UTSW 8 80614861 missense probably damaging 1.00
R1793:Frem3 UTSW 8 80613112 missense probably benign 0.03
R1872:Frem3 UTSW 8 80612576 missense probably damaging 1.00
R1879:Frem3 UTSW 8 80611938 nonsense probably null
R1886:Frem3 UTSW 8 80613885 missense probably benign 0.00
R1933:Frem3 UTSW 8 80612890 missense probably benign 0.00
R2027:Frem3 UTSW 8 80695337 missense possibly damaging 0.75
R2040:Frem3 UTSW 8 80615826 missense possibly damaging 0.92
R2050:Frem3 UTSW 8 80614891 missense probably damaging 1.00
R2079:Frem3 UTSW 8 80615103 missense probably benign 0.03
R2099:Frem3 UTSW 8 80615859 missense probably benign 0.06
R2120:Frem3 UTSW 8 80615457 missense probably benign 0.20
R2842:Frem3 UTSW 8 80669349 splice site probably null
R2845:Frem3 UTSW 8 80613220 missense probably damaging 1.00
R3015:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R3442:Frem3 UTSW 8 80613040 missense probably damaging 1.00
R3724:Frem3 UTSW 8 80615271 missense probably benign 0.06
R3730:Frem3 UTSW 8 80615916 missense probably damaging 0.99
R3939:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3940:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3941:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R4089:Frem3 UTSW 8 80615173 missense probably damaging 1.00
R4282:Frem3 UTSW 8 80614141 missense probably benign 0.00
R4437:Frem3 UTSW 8 80612607 missense probably benign 0.30
R4480:Frem3 UTSW 8 80611357 missense probably benign 0.10
R4575:Frem3 UTSW 8 80616075 missense probably benign 0.17
R4583:Frem3 UTSW 8 80613514 missense probably benign 0.03
R4620:Frem3 UTSW 8 80668957 missense possibly damaging 0.82
R4621:Frem3 UTSW 8 80669191 splice site probably null
R4644:Frem3 UTSW 8 80613727 missense probably benign 0.33
R4667:Frem3 UTSW 8 80663420 missense probably damaging 0.97
R4748:Frem3 UTSW 8 80611459 missense probably damaging 1.00
R4823:Frem3 UTSW 8 80613958 missense probably benign 0.25
R4836:Frem3 UTSW 8 80663397 missense probably damaging 0.99
R4867:Frem3 UTSW 8 80613283 missense probably damaging 1.00
R4921:Frem3 UTSW 8 80613136 missense possibly damaging 0.83
R5030:Frem3 UTSW 8 80613247 missense possibly damaging 0.89
R5035:Frem3 UTSW 8 80615914 missense probably damaging 0.97
R5172:Frem3 UTSW 8 80612566 missense probably benign 0.44
R5289:Frem3 UTSW 8 80612319 missense probably benign 0.00
R5492:Frem3 UTSW 8 80612677 missense probably damaging 1.00
R5655:Frem3 UTSW 8 80612694 missense probably benign 0.00
R5685:Frem3 UTSW 8 80695303 missense probably damaging 1.00
R5723:Frem3 UTSW 8 80613397 missense probably benign 0.02
R5743:Frem3 UTSW 8 80615778 missense probably damaging 0.98
R5889:Frem3 UTSW 8 80614288 missense probably damaging 1.00
R6048:Frem3 UTSW 8 80613433 missense probably benign 0.03
R6057:Frem3 UTSW 8 80615587 missense probably damaging 0.99
R6137:Frem3 UTSW 8 80615047 missense probably benign
R6264:Frem3 UTSW 8 80615203 missense probably damaging 1.00
R6339:Frem3 UTSW 8 80613015 missense possibly damaging 0.84
R6418:Frem3 UTSW 8 80611152 missense probably benign 0.08
R6680:Frem3 UTSW 8 80669320 missense probably damaging 1.00
R6838:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R6928:Frem3 UTSW 8 80611282 missense possibly damaging 0.48
R6939:Frem3 UTSW 8 80615145 missense probably benign 0.23
R6995:Frem3 UTSW 8 80612579 missense probably damaging 0.98
R7112:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7155:Frem3 UTSW 8 80616039 missense probably benign 0.01
R7235:Frem3 UTSW 8 80690725 missense probably benign 0.00
R7282:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7403:Frem3 UTSW 8 80616145 missense probably damaging 1.00
R7422:Frem3 UTSW 8 80615763 missense probably benign 0.00
R7485:Frem3 UTSW 8 80613336 missense probably damaging 1.00
R7516:Frem3 UTSW 8 80612083 missense probably damaging 0.99
R7858:Frem3 UTSW 8 80611721 nonsense probably null
R7976:Frem3 UTSW 8 80611602 nonsense probably null
R8171:Frem3 UTSW 8 80615240 missense probably damaging 1.00
R8185:Frem3 UTSW 8 80612304 nonsense probably null
R8306:Frem3 UTSW 8 80612211 missense possibly damaging 0.95
R8478:Frem3 UTSW 8 80611558 missense probably damaging 1.00
R8518:Frem3 UTSW 8 80612595 missense probably damaging 1.00
R8794:Frem3 UTSW 8 80612278 missense probably damaging 1.00
R8794:Frem3 UTSW 8 80616222 missense probably benign 0.02
R8806:Frem3 UTSW 8 80663435 missense probably benign 0.30
R8833:Frem3 UTSW 8 80612772 missense probably benign 0.29
R8879:Frem3 UTSW 8 80613148 missense probably damaging 0.98
R8897:Frem3 UTSW 8 80612790 missense probably damaging 1.00
R8983:Frem3 UTSW 8 80669246 missense probably damaging 1.00
R9207:Frem3 UTSW 8 80613442 missense possibly damaging 0.73
R9277:Frem3 UTSW 8 80690773 missense probably damaging 0.96
R9536:Frem3 UTSW 8 80615419 missense probably benign 0.00
R9596:Frem3 UTSW 8 80615322 missense probably benign
R9649:Frem3 UTSW 8 80614516 missense probably damaging 1.00
R9671:Frem3 UTSW 8 80612505 missense probably benign 0.00
R9723:Frem3 UTSW 8 80614723 missense probably benign
R9790:Frem3 UTSW 8 80613261 missense probably benign 0.01
R9791:Frem3 UTSW 8 80613261 missense probably benign 0.01
RF030:Frem3 UTSW 8 80615238 small insertion probably benign
RF034:Frem3 UTSW 8 80615238 small insertion probably benign
RF042:Frem3 UTSW 8 80615238 small insertion probably benign
X0024:Frem3 UTSW 8 80613081 missense possibly damaging 0.76
X0027:Frem3 UTSW 8 80612388 nonsense probably null
Z1088:Frem3 UTSW 8 80615426 missense probably benign 0.04
Z1176:Frem3 UTSW 8 80611503 missense probably damaging 0.99
Z1176:Frem3 UTSW 8 80615431 missense probably benign 0.03
Z1177:Frem3 UTSW 8 80616129 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGGCCACTGAAAGTGTTTAAAGTG -3'
(R):5'- ATCATTAGAGCCGCGAGACTAG -3'

Sequencing Primer
(F):5'- TTAAAGTGCTAGGCTGCAGC -3'
(R):5'- GCCGCGAGACTAGGTATTG -3'
Posted On 2018-08-29