Incidental Mutation 'R6773:Shisa9'
ID532261
Institutional Source Beutler Lab
Gene Symbol Shisa9
Ensembl Gene ENSMUSG00000022494
Gene Nameshisa family member 9
SynonymsCKAMP44, 2700045P11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6773 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location11984113-12270902 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11985028 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 150 (T150A)
Ref Sequence ENSEMBL: ENSMUSP00000132646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023138] [ENSMUST00000170672]
Predicted Effect probably damaging
Transcript: ENSMUST00000023138
AA Change: T150A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023138
Gene: ENSMUSG00000022494
AA Change: T150A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 28 61 N/A INTRINSIC
Pfam:Shisa 70 254 7.9e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170672
AA Change: T150A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132646
Gene: ENSMUSG00000022494
AA Change: T150A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 28 61 N/A INTRINSIC
Pfam:Shisa 71 260 2.1e-55 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 98% (44/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced AMPA-mediated synaptic currents in retinogeniculate and corticogeniculate synapses, enhanced paired-pulse facilitation in retinogeniculate synapses and decreased synaptic depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp6 A G 15: 99,602,677 D161G probably damaging Het
Aqr A T 2: 114,148,996 N319K possibly damaging Het
Asns C A 6: 7,676,284 R424L probably benign Het
Atp4a T C 7: 30,715,377 V197A probably damaging Het
Ccdc70 A G 8: 21,973,305 E37G probably damaging Het
Ccdc88b A T 19: 6,849,041 V1102E possibly damaging Het
Cd82 G A 2: 93,421,876 A130V probably benign Het
Cfap46 T C 7: 139,642,561 probably benign Het
Cnot6l A C 5: 96,094,299 C188W probably damaging Het
Cxcr6 A T 9: 123,810,290 T119S possibly damaging Het
Dok7 G A 5: 35,077,184 R193H probably damaging Het
Dpy19l1 A T 9: 24,440,772 S386T probably damaging Het
Frem3 A C 8: 80,611,815 T246P probably damaging Het
Gm29666 A T 15: 84,914,159 I67K unknown Het
Gm9774 T A 3: 92,429,249 I49F probably damaging Het
Gpr153 T A 4: 152,279,300 V59E probably damaging Het
Inpp4b G A 8: 81,856,620 probably benign Het
Kcnj13 T C 1: 87,386,760 I247V possibly damaging Het
Klri1 C T 6: 129,703,547 V91M possibly damaging Het
M1ap T A 6: 82,968,080 D118E probably damaging Het
Map4 T C 9: 110,034,925 V406A probably benign Het
Nedd4l T C 18: 65,167,551 V369A probably benign Het
Olfr206 A T 16: 59,345,216 L162I probably damaging Het
Otud4 A G 8: 79,643,806 Y71C possibly damaging Het
Plcl1 A G 1: 55,751,302 N1044D probably benign Het
Ppp4r3b T A 11: 29,205,639 M114K probably benign Het
Prune1 T C 3: 95,263,771 D114G probably damaging Het
Rad54l2 A T 9: 106,693,317 V1268D probably benign Het
Rbbp6 A G 7: 122,999,355 probably benign Het
Rimbp3 A T 16: 17,209,015 E101V probably damaging Het
Rit1 C T 3: 88,726,369 probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Smpdl3a T C 10: 57,802,437 V112A probably damaging Het
Strada T A 11: 106,164,907 I305F probably damaging Het
Svep1 C T 4: 58,049,146 E3454K possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tmem259 T C 10: 79,977,588 D519G possibly damaging Het
Tns1 T C 1: 73,919,707 Q445R probably damaging Het
Topbp1 A G 9: 103,343,692 D20G possibly damaging Het
Trbv5 G T 6: 41,062,617 W52L probably damaging Het
Trpc6 A T 9: 8,634,057 H379L probably damaging Het
Tulp1 T C 17: 28,362,902 K193E probably damaging Het
Unc80 T C 1: 66,651,543 V2459A probably benign Het
Vps50 T C 6: 3,592,560 V731A probably benign Het
Other mutations in Shisa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Shisa9 APN 16 12244658 missense probably benign 0.04
IGL02011:Shisa9 APN 16 12244638 missense possibly damaging 0.87
IGL02884:Shisa9 APN 16 11997043 splice site probably benign
PIT4508001:Shisa9 UTSW 16 12267480 missense probably benign 0.00
R0194:Shisa9 UTSW 16 11984954 missense probably damaging 1.00
R0309:Shisa9 UTSW 16 11997123 missense probably damaging 1.00
R0588:Shisa9 UTSW 16 12267774 missense probably damaging 0.99
R1469:Shisa9 UTSW 16 11985071 missense probably damaging 1.00
R1469:Shisa9 UTSW 16 11985071 missense probably damaging 1.00
R1781:Shisa9 UTSW 16 12267657 missense probably benign 0.00
R1818:Shisa9 UTSW 16 12267562 missense probably damaging 0.96
R1943:Shisa9 UTSW 16 12267756 missense probably benign 0.06
R2263:Shisa9 UTSW 16 11984767 missense possibly damaging 0.53
R3742:Shisa9 UTSW 16 12267664 missense probably damaging 1.00
R5068:Shisa9 UTSW 16 12267548 missense possibly damaging 0.48
R5977:Shisa9 UTSW 16 12267428 missense probably benign 0.01
R6032:Shisa9 UTSW 16 11984908 missense possibly damaging 0.76
R6032:Shisa9 UTSW 16 11984908 missense possibly damaging 0.76
R6487:Shisa9 UTSW 16 12244611 missense probably benign 0.01
R8341:Shisa9 UTSW 16 11997151 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- TCGGGCGACTTCATCTTCTG -3'
(R):5'- ATTCCCCAATCGGAGACCTTG -3'

Sequencing Primer
(F):5'- CATCTTCTGCTGCGGGAC -3'
(R):5'- CACGGCTGGGGAATGTTG -3'
Posted On2018-08-29