Incidental Mutation 'R6774:Rapgef4'
ID532272
Institutional Source Beutler Lab
Gene Symbol Rapgef4
Ensembl Gene ENSMUSG00000049044
Gene NameRap guanine nucleotide exchange factor (GEF) 4
SynonymscAMP-GEFII, Epac2, 1300003D15Rik, 5730402K07Rik, 6330581N18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.663) question?
Stock #R6774 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location71981240-72257474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72225775 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 624 (K624R)
Ref Sequence ENSEMBL: ENSMUSP00000099759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028525] [ENSMUST00000090826] [ENSMUST00000102698]
Predicted Effect probably benign
Transcript: ENSMUST00000028525
AA Change: K498R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000028525
Gene: ENSMUSG00000049044
AA Change: K498R

DomainStartEndE-ValueType
DEP 72 147 3.43e-27 SMART
low complexity region 158 167 N/A INTRINSIC
cNMP 212 331 4.02e-15 SMART
RasGEFN 351 486 3.61e-7 SMART
Blast:RasGEF 534 607 1e-33 BLAST
RasGEF 624 866 8.09e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090826
AA Change: K642R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000088336
Gene: ENSMUSG00000049044
AA Change: K642R

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
cNMP 43 162 4.62e-15 SMART
DEP 216 291 3.43e-27 SMART
low complexity region 302 311 N/A INTRINSIC
cNMP 356 475 4.02e-15 SMART
RasGEFN 495 630 3.61e-7 SMART
Blast:RasGEF 678 751 2e-33 BLAST
RasGEF 768 1010 8.09e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102698
AA Change: K624R

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099759
Gene: ENSMUSG00000049044
AA Change: K624R

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
cNMP 43 162 4.62e-15 SMART
DEP 198 273 3.43e-27 SMART
low complexity region 284 293 N/A INTRINSIC
cNMP 338 457 4.02e-15 SMART
RasGEFN 477 612 3.61e-7 SMART
Blast:RasGEF 660 733 2e-33 BLAST
RasGEF 750 992 8.09e-105 SMART
Meta Mutation Damage Score 0.0834 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin granule fusion in pancreatic islet cells during the first phase of cAMP-dependent insulin granule exocytosis. Mice homozygous for a knock-out allele exhibit impaired isoproterenol-induced SR calcium leak and arrhythmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
9930111J21Rik1 A G 11: 48,947,316 S815P possibly damaging Het
A430033K04Rik A G 5: 138,646,450 Y199C probably benign Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Ccdc103 T C 11: 102,882,693 F47S probably damaging Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gcc2 A G 10: 58,281,439 N1170S possibly damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kif17 A G 4: 138,274,995 Y170C probably damaging Het
Kti12 G A 4: 108,848,455 G189R probably benign Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mmp1b T C 9: 7,387,914 K27E probably benign Het
Mob4 A G 1: 55,148,429 probably null Het
Myc G A 15: 61,988,279 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Ntng2 T C 2: 29,197,090 T373A probably damaging Het
Olfr1200 C T 2: 88,767,884 V144I probably benign Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr469 T A 7: 107,823,188 T94S probably benign Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Pard3 T C 8: 127,410,747 L859P probably damaging Het
Ppcs T C 4: 119,419,088 D100G probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Pwwp2b T C 7: 139,255,987 V448A probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim27 T A 13: 21,192,454 H457Q probably damaging Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp10 T C 8: 119,951,972 L564P probably benign Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Uspl1 T A 5: 149,214,094 D701E probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Zfp712 T C 13: 67,041,504 T320A probably benign Het
Other mutations in Rapgef4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Rapgef4 APN 2 72256312 missense possibly damaging 0.75
IGL00858:Rapgef4 APN 2 72198897 missense probably damaging 1.00
IGL01408:Rapgef4 APN 2 72174841 nonsense probably null
IGL01673:Rapgef4 APN 2 72241437 missense probably damaging 0.99
IGL01678:Rapgef4 APN 2 72242225 splice site probably benign
IGL01725:Rapgef4 APN 2 72174874 missense probably benign 0.24
IGL01871:Rapgef4 APN 2 72198360 missense possibly damaging 0.69
IGL01935:Rapgef4 APN 2 72234123 missense probably benign 0.05
IGL02001:Rapgef4 APN 2 72225052 splice site probably benign
IGL02041:Rapgef4 APN 2 72198796 missense probably damaging 1.00
IGL02134:Rapgef4 APN 2 72180061 missense probably damaging 0.97
IGL02410:Rapgef4 APN 2 72226594 missense possibly damaging 0.51
IGL02807:Rapgef4 APN 2 72205649 splice site probably benign
IGL03066:Rapgef4 APN 2 72141179 splice site probably benign
IGL03282:Rapgef4 APN 2 72205752 splice site probably benign
IGL03291:Rapgef4 APN 2 72195703 missense probably damaging 1.00
P0033:Rapgef4 UTSW 2 72137331 intron probably benign
R0045:Rapgef4 UTSW 2 72198778 missense possibly damaging 0.80
R0045:Rapgef4 UTSW 2 72198778 missense possibly damaging 0.80
R0309:Rapgef4 UTSW 2 72226030 missense probably benign 0.02
R0398:Rapgef4 UTSW 2 72031041 missense probably damaging 0.99
R0747:Rapgef4 UTSW 2 72223073 missense possibly damaging 0.66
R1216:Rapgef4 UTSW 2 72208148 missense possibly damaging 0.51
R1264:Rapgef4 UTSW 2 72031105 missense possibly damaging 0.48
R1302:Rapgef4 UTSW 2 72045160 missense probably benign 0.31
R1460:Rapgef4 UTSW 2 72031176 critical splice donor site probably null
R1483:Rapgef4 UTSW 2 72055026 critical splice donor site probably null
R1682:Rapgef4 UTSW 2 72226568 missense possibly damaging 0.80
R1768:Rapgef4 UTSW 2 72225787 splice site probably benign
R1858:Rapgef4 UTSW 2 72031064 missense possibly damaging 0.67
R1860:Rapgef4 UTSW 2 72234720 missense probably benign 0.05
R1952:Rapgef4 UTSW 2 72208127 missense probably benign 0.07
R2025:Rapgef4 UTSW 2 72242739 missense probably benign 0.01
R2128:Rapgef4 UTSW 2 72226553 missense possibly damaging 0.87
R2159:Rapgef4 UTSW 2 72174881 missense probably damaging 1.00
R2201:Rapgef4 UTSW 2 72045189 missense probably damaging 0.96
R2883:Rapgef4 UTSW 2 72031125 missense probably benign
R3015:Rapgef4 UTSW 2 72198373 missense probably damaging 1.00
R4278:Rapgef4 UTSW 2 72198395 missense possibly damaging 0.95
R5256:Rapgef4 UTSW 2 72034034 missense probably damaging 0.97
R5572:Rapgef4 UTSW 2 72034120 critical splice donor site probably null
R5574:Rapgef4 UTSW 2 72034120 critical splice donor site probably null
R5575:Rapgef4 UTSW 2 72034120 critical splice donor site probably null
R5749:Rapgef4 UTSW 2 72242757 missense probably damaging 1.00
R6007:Rapgef4 UTSW 2 72179949 missense possibly damaging 0.55
R6084:Rapgef4 UTSW 2 72196278 critical splice donor site probably null
R6192:Rapgef4 UTSW 2 71981317 missense probably benign 0.00
R6409:Rapgef4 UTSW 2 72178237 missense probably benign 0.01
R6683:Rapgef4 UTSW 2 72054779 intron probably benign
R6844:Rapgef4 UTSW 2 72234626 missense probably damaging 0.99
R6999:Rapgef4 UTSW 2 72239125 missense probably damaging 1.00
R7077:Rapgef4 UTSW 2 72241476 missense probably damaging 0.96
R7138:Rapgef4 UTSW 2 72198363 missense probably damaging 1.00
R7275:Rapgef4 UTSW 2 72208101 missense probably damaging 1.00
R7352:Rapgef4 UTSW 2 72180091 missense probably damaging 1.00
R7397:Rapgef4 UTSW 2 72205666 missense probably benign 0.23
R7508:Rapgef4 UTSW 2 72205733 missense probably benign 0.00
R7620:Rapgef4 UTSW 2 72229078 missense probably damaging 0.99
R7703:Rapgef4 UTSW 2 72179971 missense probably benign 0.28
R7770:Rapgef4 UTSW 2 72198395 missense possibly damaging 0.95
R7814:Rapgef4 UTSW 2 72223117 missense probably benign
R7868:Rapgef4 UTSW 2 72201137 missense probably benign 0.11
R8210:Rapgef4 UTSW 2 72226020 missense probably benign 0.00
X0062:Rapgef4 UTSW 2 72226607 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGATCTGCCTGTGACAAGAG -3'
(R):5'- ACTTGGAGAAGATGCATCCGAG -3'

Sequencing Primer
(F):5'- ATCTGCCTGTGACAAGAGCTAGTG -3'
(R):5'- TCCGAGAAGCAATTAGAGCC -3'
Posted On2018-08-29