Incidental Mutation 'R6774:Olfr1200'
ID532273
Institutional Source Beutler Lab
Gene Symbol Olfr1200
Ensembl Gene ENSMUSG00000075115
Gene Nameolfactory receptor 1200
SynonymsMOR225-12, GA_x6K02T2Q125-50243231-50242221
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6774 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88763511-88770488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88767884 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 144 (V144I)
Ref Sequence ENSEMBL: ENSMUSP00000149757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099811] [ENSMUST00000217588]
Predicted Effect probably benign
Transcript: ENSMUST00000099811
AA Change: V144I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000097399
Gene: ENSMUSG00000075115
AA Change: V144I

DomainStartEndE-ValueType
Pfam:7tm_4 29 302 3.2e-47 PFAM
Pfam:7tm_1 39 285 2.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217588
AA Change: V144I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
9930111J21Rik1 A G 11: 48,947,316 S815P possibly damaging Het
A430033K04Rik A G 5: 138,646,450 Y199C probably benign Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Ccdc103 T C 11: 102,882,693 F47S probably damaging Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gcc2 A G 10: 58,281,439 N1170S possibly damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kif17 A G 4: 138,274,995 Y170C probably damaging Het
Kti12 G A 4: 108,848,455 G189R probably benign Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mmp1b T C 9: 7,387,914 K27E probably benign Het
Mob4 A G 1: 55,148,429 probably null Het
Myc G A 15: 61,988,279 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Ntng2 T C 2: 29,197,090 T373A probably damaging Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr469 T A 7: 107,823,188 T94S probably benign Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Pard3 T C 8: 127,410,747 L859P probably damaging Het
Ppcs T C 4: 119,419,088 D100G probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Pwwp2b T C 7: 139,255,987 V448A probably benign Het
Rapgef4 A G 2: 72,225,775 K624R probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim27 T A 13: 21,192,454 H457Q probably damaging Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp10 T C 8: 119,951,972 L564P probably benign Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Uspl1 T A 5: 149,214,094 D701E probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Zfp712 T C 13: 67,041,504 T320A probably benign Het
Other mutations in Olfr1200
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Olfr1200 APN 2 88767466 missense probably benign 0.01
PIT4520001:Olfr1200 UTSW 2 88767577 missense possibly damaging 0.95
R0375:Olfr1200 UTSW 2 88767641 missense possibly damaging 0.77
R0525:Olfr1200 UTSW 2 88767314 nonsense probably null
R1467:Olfr1200 UTSW 2 88767488 missense probably benign 0.02
R1467:Olfr1200 UTSW 2 88767488 missense probably benign 0.02
R1613:Olfr1200 UTSW 2 88767805 missense probably damaging 1.00
R2224:Olfr1200 UTSW 2 88767586 missense possibly damaging 0.89
R2760:Olfr1200 UTSW 2 88767636 missense possibly damaging 0.61
R3434:Olfr1200 UTSW 2 88768069 missense probably damaging 1.00
R6156:Olfr1200 UTSW 2 88767590 missense probably benign 0.01
R6251:Olfr1200 UTSW 2 88768288 missense probably damaging 1.00
R6582:Olfr1200 UTSW 2 88768243 missense probably damaging 0.96
R6592:Olfr1200 UTSW 2 88768127 missense probably damaging 1.00
R6600:Olfr1200 UTSW 2 88767757 missense probably benign 0.02
R7140:Olfr1200 UTSW 2 88767964 missense probably damaging 1.00
R8335:Olfr1200 UTSW 2 88767773 missense probably damaging 1.00
X0026:Olfr1200 UTSW 2 88767433 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTTCCCTGCAGATGATCTTG -3'
(R):5'- ATCAGGGACTTGGCAGCAAC -3'

Sequencing Primer
(F):5'- CTGCAGATGATCTTGTCCTCAGAG -3'
(R):5'- TGGCAGGTGTGGAAATCT -3'
Posted On2018-08-29