Incidental Mutation 'R6774:Kti12'
ID532276
Institutional Source Beutler Lab
Gene Symbol Kti12
Ensembl Gene ENSMUSG00000073775
Gene NameKTI12 homolog, chromatin associated
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6774 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location108847785-108849413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108848455 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 189 (G189R)
Ref Sequence ENSEMBL: ENSMUSP00000099799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030296] [ENSMUST00000102738] [ENSMUST00000164855]
Predicted Effect probably benign
Transcript: ENSMUST00000030296
SMART Domains Protein: ENSMUSP00000030296
Gene: ENSMUSG00000028567

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:Thioredoxin_7 37 118 1.1e-19 PFAM
Pfam:Thioredoxin 41 135 1.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102738
AA Change: G189R

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099799
Gene: ENSMUSG00000073775
AA Change: G189R

DomainStartEndE-ValueType
Pfam:KTI12 1 347 3.3e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164855
SMART Domains Protein: ENSMUSP00000128780
Gene: ENSMUSG00000090551

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
low complexity region 47 64 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
9930111J21Rik1 A G 11: 48,947,316 S815P possibly damaging Het
A430033K04Rik A G 5: 138,646,450 Y199C probably benign Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Ccdc103 T C 11: 102,882,693 F47S probably damaging Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gcc2 A G 10: 58,281,439 N1170S possibly damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kif17 A G 4: 138,274,995 Y170C probably damaging Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mmp1b T C 9: 7,387,914 K27E probably benign Het
Mob4 A G 1: 55,148,429 probably null Het
Myc G A 15: 61,988,279 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Ntng2 T C 2: 29,197,090 T373A probably damaging Het
Olfr1200 C T 2: 88,767,884 V144I probably benign Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr469 T A 7: 107,823,188 T94S probably benign Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Pard3 T C 8: 127,410,747 L859P probably damaging Het
Ppcs T C 4: 119,419,088 D100G probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Pwwp2b T C 7: 139,255,987 V448A probably benign Het
Rapgef4 A G 2: 72,225,775 K624R probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim27 T A 13: 21,192,454 H457Q probably damaging Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp10 T C 8: 119,951,972 L564P probably benign Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Uspl1 T A 5: 149,214,094 D701E probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Zfp712 T C 13: 67,041,504 T320A probably benign Het
Other mutations in Kti12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02608:Kti12 APN 4 108848162 missense probably damaging 1.00
IGL02891:Kti12 APN 4 108848533 missense probably benign
IGL03142:Kti12 APN 4 108848165 missense probably damaging 1.00
BB002:Kti12 UTSW 4 108848246 missense probably benign
BB002:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB003:Kti12 UTSW 4 108848246 missense probably benign
BB003:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB004:Kti12 UTSW 4 108848246 missense probably benign
BB004:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB006:Kti12 UTSW 4 108848246 missense probably benign
BB006:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB012:Kti12 UTSW 4 108848246 missense probably benign
BB012:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB013:Kti12 UTSW 4 108848246 missense probably benign
BB013:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB014:Kti12 UTSW 4 108848246 missense probably benign
BB014:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB016:Kti12 UTSW 4 108848246 missense probably benign
BB016:Kti12 UTSW 4 108848247 missense probably benign 0.00
R0518:Kti12 UTSW 4 108848579 missense possibly damaging 0.95
R1681:Kti12 UTSW 4 108848858 missense probably damaging 1.00
R5510:Kti12 UTSW 4 108848624 missense probably damaging 1.00
R5522:Kti12 UTSW 4 108848423 missense possibly damaging 0.58
R6652:Kti12 UTSW 4 108848533 missense probably benign 0.00
R7123:Kti12 UTSW 4 108848482 missense probably benign 0.00
R7856:Kti12 UTSW 4 108848246 missense probably benign
R7856:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7858:Kti12 UTSW 4 108848246 missense probably benign
R7858:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7859:Kti12 UTSW 4 108848246 missense probably benign
R7859:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7925:Kti12 UTSW 4 108848246 missense probably benign
R7925:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7926:Kti12 UTSW 4 108848246 missense probably benign
R7926:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7927:Kti12 UTSW 4 108848246 missense probably benign
R7927:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7929:Kti12 UTSW 4 108848246 missense probably benign
R7929:Kti12 UTSW 4 108848247 missense probably benign 0.00
R8099:Kti12 UTSW 4 108848374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACTTTACTGCGTGCGGCC -3'
(R):5'- TTCTCAAACAAGGCAGACCGG -3'

Sequencing Primer
(F):5'- ACCTGGCTGTCAGCGTGAG -3'
(R):5'- AAGGCAGACCGGATCTCC -3'
Posted On2018-08-29