Incidental Mutation 'R6774:Ppcs'
ID532277
Institutional Source Beutler Lab
Gene Symbol Ppcs
Ensembl Gene ENSMUSG00000028636
Gene Namephosphopantothenoylcysteine synthetase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R6774 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location119418530-119422420 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119419088 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 100 (D100G)
Ref Sequence ENSEMBL: ENSMUSP00000101923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030385] [ENSMUST00000063642] [ENSMUST00000094819] [ENSMUST00000106316]
Predicted Effect probably damaging
Transcript: ENSMUST00000030385
AA Change: D273G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030385
Gene: ENSMUSG00000028636
AA Change: D273G

DomainStartEndE-ValueType
Pfam:DFP 33 96 1.2e-9 PFAM
Pfam:DFP 117 276 8.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063642
SMART Domains Protein: ENSMUSP00000070621
Gene: ENSMUSG00000028637

DomainStartEndE-ValueType
Pfam:DUF4686 170 547 5.1e-155 PFAM
low complexity region 555 568 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094819
SMART Domains Protein: ENSMUSP00000092414
Gene: ENSMUSG00000070806

DomainStartEndE-ValueType
Pfam:zf-MYND 17 54 1.2e-10 PFAM
low complexity region 70 87 N/A INTRINSIC
Blast:TPR 88 121 2e-14 BLAST
Pfam:TPR_8 130 157 3.9e-3 PFAM
Pfam:TPR_8 172 196 1.5e-2 PFAM
Blast:TPR 214 247 2e-13 BLAST
low complexity region 305 319 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106316
AA Change: D100G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101923
Gene: ENSMUSG00000028636
AA Change: D100G

DomainStartEndE-ValueType
Pfam:DFP 1 107 5.2e-14 PFAM
Meta Mutation Damage Score 0.4281 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. PPCS (EC 6.3.2.5), one of the last enzymes in this pathway, converts phosphopantothenate to phosphopantothenoylcysteine (Daugherty et al., 2002 [PubMed 11923312]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
9930111J21Rik1 A G 11: 48,947,316 S815P possibly damaging Het
A430033K04Rik A G 5: 138,646,450 Y199C probably benign Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Ccdc103 T C 11: 102,882,693 F47S probably damaging Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gcc2 A G 10: 58,281,439 N1170S possibly damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kif17 A G 4: 138,274,995 Y170C probably damaging Het
Kti12 G A 4: 108,848,455 G189R probably benign Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mmp1b T C 9: 7,387,914 K27E probably benign Het
Mob4 A G 1: 55,148,429 probably null Het
Myc G A 15: 61,988,279 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Ntng2 T C 2: 29,197,090 T373A probably damaging Het
Olfr1200 C T 2: 88,767,884 V144I probably benign Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr469 T A 7: 107,823,188 T94S probably benign Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Pard3 T C 8: 127,410,747 L859P probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Pwwp2b T C 7: 139,255,987 V448A probably benign Het
Rapgef4 A G 2: 72,225,775 K624R probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim27 T A 13: 21,192,454 H457Q probably damaging Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp10 T C 8: 119,951,972 L564P probably benign Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Uspl1 T A 5: 149,214,094 D701E probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Zfp712 T C 13: 67,041,504 T320A probably benign Het
Other mutations in Ppcs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02438:Ppcs APN 4 119421692 splice site probably benign
R0788:Ppcs UTSW 4 119422178 missense probably damaging 1.00
R2285:Ppcs UTSW 4 119418977 missense possibly damaging 0.94
R4260:Ppcs UTSW 4 119421909 missense probably damaging 1.00
R4261:Ppcs UTSW 4 119421909 missense probably damaging 1.00
R4817:Ppcs UTSW 4 119419146 missense probably benign 0.34
R5061:Ppcs UTSW 4 119419215 missense probably damaging 1.00
R6962:Ppcs UTSW 4 119422178 missense probably damaging 1.00
R7961:Ppcs UTSW 4 119419065 missense probably benign 0.15
R8009:Ppcs UTSW 4 119419065 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TGCACACCGCGTTTACTATC -3'
(R):5'- GCCAAAGATGCTTTCCCCTC -3'

Sequencing Primer
(F):5'- CACTGTGTTGATCCTTAACAGAGG -3'
(R):5'- TCTGGTCAAAGACTGGGCTC -3'
Posted On2018-08-29