Incidental Mutation 'R6774:A430033K04Rik'
ID532280
Institutional Source Beutler Lab
Gene Symbol A430033K04Rik
Ensembl Gene ENSMUSG00000056014
Gene NameRIKEN cDNA A430033K04 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6774 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location138622859-138652414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138646450 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 199 (Y199C)
Ref Sequence ENSEMBL: ENSMUSP00000142904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069862] [ENSMUST00000198958]
Predicted Effect unknown
Transcript: ENSMUST00000069862
AA Change: Y199C
SMART Domains Protein: ENSMUSP00000067316
Gene: ENSMUSG00000056014
AA Change: Y199C

DomainStartEndE-ValueType
KRAB 16 76 6.23e-34 SMART
ZnF_C2H2 261 280 1.01e2 SMART
ZnF_C2H2 455 477 1.47e-3 SMART
ZnF_C2H2 483 505 4.05e-1 SMART
ZnF_C2H2 511 533 5.5e-3 SMART
ZnF_C2H2 539 561 7.26e-3 SMART
ZnF_C2H2 567 589 5.14e-3 SMART
ZnF_C2H2 595 617 3.63e-3 SMART
ZnF_C2H2 623 645 1.92e-2 SMART
ZnF_C2H2 651 673 2.12e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198958
AA Change: Y199C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142904
Gene: ENSMUSG00000056014
AA Change: Y199C

DomainStartEndE-ValueType
KRAB 16 76 2.7e-36 SMART
ZnF_C2H2 261 280 4.2e-1 SMART
ZnF_C2H2 455 477 6.4e-6 SMART
ZnF_C2H2 483 505 1.8e-3 SMART
ZnF_C2H2 511 533 2.3e-5 SMART
ZnF_C2H2 539 561 3e-5 SMART
ZnF_C2H2 567 589 2.1e-5 SMART
ZnF_C2H2 595 617 1.5e-5 SMART
ZnF_C2H2 623 643 2.7e-1 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
9930111J21Rik1 A G 11: 48,947,316 S815P possibly damaging Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Ccdc103 T C 11: 102,882,693 F47S probably damaging Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gcc2 A G 10: 58,281,439 N1170S possibly damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kif17 A G 4: 138,274,995 Y170C probably damaging Het
Kti12 G A 4: 108,848,455 G189R probably benign Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mmp1b T C 9: 7,387,914 K27E probably benign Het
Mob4 A G 1: 55,148,429 probably null Het
Myc G A 15: 61,988,279 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Ntng2 T C 2: 29,197,090 T373A probably damaging Het
Olfr1200 C T 2: 88,767,884 V144I probably benign Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr469 T A 7: 107,823,188 T94S probably benign Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Pard3 T C 8: 127,410,747 L859P probably damaging Het
Ppcs T C 4: 119,419,088 D100G probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Pwwp2b T C 7: 139,255,987 V448A probably benign Het
Rapgef4 A G 2: 72,225,775 K624R probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim27 T A 13: 21,192,454 H457Q probably damaging Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp10 T C 8: 119,951,972 L564P probably benign Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Uspl1 T A 5: 149,214,094 D701E probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Zfp712 T C 13: 67,041,504 T320A probably benign Het
Other mutations in A430033K04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:A430033K04Rik APN 5 138647592 missense probably damaging 1.00
IGL00336:A430033K04Rik APN 5 138647104 missense probably damaging 0.99
IGL02615:A430033K04Rik APN 5 138646140 nonsense probably null
IGL03354:A430033K04Rik APN 5 138646779 missense possibly damaging 0.85
R0172:A430033K04Rik UTSW 5 138647316 missense probably damaging 0.99
R1769:A430033K04Rik UTSW 5 138646257 missense probably benign 0.04
R4515:A430033K04Rik UTSW 5 138647744 missense probably damaging 1.00
R4903:A430033K04Rik UTSW 5 138646857 nonsense probably null
R4964:A430033K04Rik UTSW 5 138646857 nonsense probably null
R5389:A430033K04Rik UTSW 5 138646297 missense probably benign 0.02
R5769:A430033K04Rik UTSW 5 138646333 missense possibly damaging 0.86
R6128:A430033K04Rik UTSW 5 138647776 missense probably damaging 1.00
R6399:A430033K04Rik UTSW 5 138647559 missense probably damaging 1.00
R6444:A430033K04Rik UTSW 5 138639569 small deletion probably benign
R6600:A430033K04Rik UTSW 5 138647448 frame shift probably null
R7098:A430033K04Rik UTSW 5 138646522 missense probably benign
R7217:A430033K04Rik UTSW 5 138646926 missense probably benign
R7269:A430033K04Rik UTSW 5 138646752 missense possibly damaging 0.86
R7429:A430033K04Rik UTSW 5 138636183 missense possibly damaging 0.92
R7442:A430033K04Rik UTSW 5 138647247 missense possibly damaging 0.55
R7718:A430033K04Rik UTSW 5 138647860 missense possibly damaging 0.73
R8007:A430033K04Rik UTSW 5 138646639 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GAAGAATGAAGTCTGTTCTAGAGTG -3'
(R):5'- GCATAGCGTCATGGTTGCTAAG -3'

Sequencing Primer
(F):5'- GTTCTTTCAGGAGCTTGTTAATCC -3'
(R):5'- TCCCAAAGTTTGCTTTCTTAACTGAG -3'
Posted On2018-08-29