Incidental Mutation 'R6774:Uspl1'
ID532281
Institutional Source Beutler Lab
Gene Symbol Uspl1
Ensembl Gene ENSMUSG00000041264
Gene Nameubiquitin specific peptidase like 1
SynonymsE430026A01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R6774 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location149184350-149215434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 149214094 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 701 (D701E)
Ref Sequence ENSEMBL: ENSMUSP00000113247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050472] [ENSMUST00000100410] [ENSMUST00000117878] [ENSMUST00000119685] [ENSMUST00000121416] [ENSMUST00000122160] [ENSMUST00000126168]
Predicted Effect probably benign
Transcript: ENSMUST00000050472
AA Change: D701E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000050172
Gene: ENSMUSG00000041264
AA Change: D701E

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 213 486 7e-139 PFAM
Pfam:DUF4650 557 1087 1.9e-213 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100410
SMART Domains Protein: ENSMUSP00000097978
Gene: ENSMUSG00000041264

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 213 486 1.4e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117878
SMART Domains Protein: ENSMUSP00000113176
Gene: ENSMUSG00000041264

DomainStartEndE-ValueType
Pfam:Peptidase_C98 14 287 5.6e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119685
AA Change: D687E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114104
Gene: ENSMUSG00000041264
AA Change: D687E

DomainStartEndE-ValueType
low complexity region 160 178 N/A INTRINSIC
Pfam:Peptidase_C98 199 472 6.9e-139 PFAM
Pfam:DUF4650 543 1073 1.8e-213 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121416
AA Change: D502E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113894
Gene: ENSMUSG00000041264
AA Change: D502E

DomainStartEndE-ValueType
Pfam:Peptidase_C98 14 287 8.5e-139 PFAM
Pfam:DUF4650 358 888 1.5e-213 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122160
AA Change: D701E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113247
Gene: ENSMUSG00000041264
AA Change: D701E

DomainStartEndE-ValueType
low complexity region 174 192 N/A INTRINSIC
Pfam:Peptidase_C98 214 486 2.5e-125 PFAM
Pfam:DUF4650 558 1087 1e-205 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126168
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
9930111J21Rik1 A G 11: 48,947,316 S815P possibly damaging Het
A430033K04Rik A G 5: 138,646,450 Y199C probably benign Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Ccdc103 T C 11: 102,882,693 F47S probably damaging Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gcc2 A G 10: 58,281,439 N1170S possibly damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kif17 A G 4: 138,274,995 Y170C probably damaging Het
Kti12 G A 4: 108,848,455 G189R probably benign Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mmp1b T C 9: 7,387,914 K27E probably benign Het
Mob4 A G 1: 55,148,429 probably null Het
Myc G A 15: 61,988,279 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Ntng2 T C 2: 29,197,090 T373A probably damaging Het
Olfr1200 C T 2: 88,767,884 V144I probably benign Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr469 T A 7: 107,823,188 T94S probably benign Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Pard3 T C 8: 127,410,747 L859P probably damaging Het
Ppcs T C 4: 119,419,088 D100G probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Pwwp2b T C 7: 139,255,987 V448A probably benign Het
Rapgef4 A G 2: 72,225,775 K624R probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim27 T A 13: 21,192,454 H457Q probably damaging Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp10 T C 8: 119,951,972 L564P probably benign Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Zfp712 T C 13: 67,041,504 T320A probably benign Het
Other mutations in Uspl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Uspl1 APN 5 149215214 missense possibly damaging 0.95
IGL00571:Uspl1 APN 5 149188360 missense probably damaging 0.99
IGL01134:Uspl1 APN 5 149204293 missense probably damaging 1.00
IGL02222:Uspl1 APN 5 149194044 missense probably benign 0.25
IGL02383:Uspl1 APN 5 149213402 missense probably damaging 0.98
IGL02538:Uspl1 APN 5 149188459 missense probably damaging 1.00
IGL02546:Uspl1 APN 5 149204304 missense possibly damaging 0.95
IGL02585:Uspl1 APN 5 149214062 nonsense probably null
IGL02971:Uspl1 APN 5 149188346 missense possibly damaging 0.84
R0020:Uspl1 UTSW 5 149209779 missense probably damaging 1.00
R0070:Uspl1 UTSW 5 149209705 missense probably damaging 1.00
R0142:Uspl1 UTSW 5 149188349 missense possibly damaging 0.68
R0433:Uspl1 UTSW 5 149214815 missense probably damaging 1.00
R0554:Uspl1 UTSW 5 149187834 missense probably damaging 1.00
R0612:Uspl1 UTSW 5 149214957 missense probably damaging 1.00
R1195:Uspl1 UTSW 5 149194321 missense probably benign 0.24
R1195:Uspl1 UTSW 5 149194321 missense probably benign 0.24
R1195:Uspl1 UTSW 5 149194321 missense probably benign 0.24
R1465:Uspl1 UTSW 5 149214032 missense probably benign 0.12
R1465:Uspl1 UTSW 5 149214032 missense probably benign 0.12
R1623:Uspl1 UTSW 5 149215199 missense probably damaging 1.00
R1737:Uspl1 UTSW 5 149201858 missense probably damaging 1.00
R1793:Uspl1 UTSW 5 149213436 missense probably damaging 1.00
R1823:Uspl1 UTSW 5 149214414 missense probably benign 0.25
R2088:Uspl1 UTSW 5 149209750 missense probably damaging 1.00
R2099:Uspl1 UTSW 5 149214758 missense probably damaging 1.00
R2497:Uspl1 UTSW 5 149187854 missense probably damaging 0.98
R2944:Uspl1 UTSW 5 149201796 missense probably damaging 1.00
R3437:Uspl1 UTSW 5 149214697 utr 3 prime probably benign
R4132:Uspl1 UTSW 5 149204349 missense probably damaging 0.99
R4458:Uspl1 UTSW 5 149214152 missense possibly damaging 0.82
R4537:Uspl1 UTSW 5 149187778 missense possibly damaging 0.66
R4623:Uspl1 UTSW 5 149214595 missense probably damaging 0.99
R4633:Uspl1 UTSW 5 149214392 missense probably damaging 1.00
R4737:Uspl1 UTSW 5 149194339 missense possibly damaging 0.86
R4743:Uspl1 UTSW 5 149209756 missense probably damaging 1.00
R5200:Uspl1 UTSW 5 149214113 missense probably benign 0.02
R5222:Uspl1 UTSW 5 149214101 missense possibly damaging 0.77
R5337:Uspl1 UTSW 5 149214746 missense probably damaging 0.99
R5496:Uspl1 UTSW 5 149209779 missense probably damaging 1.00
R5654:Uspl1 UTSW 5 149209711 missense probably damaging 1.00
R5845:Uspl1 UTSW 5 149193960 missense probably benign 0.01
R6266:Uspl1 UTSW 5 149204366 missense probably damaging 1.00
R6331:Uspl1 UTSW 5 149214287 missense probably benign 0.40
R6338:Uspl1 UTSW 5 149215034 missense probably benign 0.03
R6855:Uspl1 UTSW 5 149187845 missense probably damaging 1.00
R7131:Uspl1 UTSW 5 149193935 missense probably benign 0.00
R7152:Uspl1 UTSW 5 149187778 missense possibly damaging 0.66
R7446:Uspl1 UTSW 5 149204272 nonsense probably null
R7661:Uspl1 UTSW 5 149215017 missense probably benign 0.15
R8095:Uspl1 UTSW 5 149214182 nonsense probably null
R8126:Uspl1 UTSW 5 149214620 missense probably damaging 1.00
R8316:Uspl1 UTSW 5 149198681 missense possibly damaging 0.75
X0019:Uspl1 UTSW 5 149214267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGAAGGAAAGCTAGTTGCC -3'
(R):5'- GGTTGGCATAAAAGCACCACC -3'

Sequencing Primer
(F):5'- AAAGCTAGTTGCCCCATGTG -3'
(R):5'- GCACCACCCCTGCTCAATAG -3'
Posted On2018-08-29