Incidental Mutation 'R6774:Usp10'
ID532288
Institutional Source Beutler Lab
Gene Symbol Usp10
Ensembl Gene ENSMUSG00000031826
Gene Nameubiquitin specific peptidase 10
SynonymsUchrp, 2610014N07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6774 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location119910360-119957560 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119951972 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 564 (L564P)
Ref Sequence ENSEMBL: ENSMUSP00000123590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108982] [ENSMUST00000108988] [ENSMUST00000127664] [ENSMUST00000144458]
Predicted Effect probably benign
Transcript: ENSMUST00000108982
SMART Domains Protein: ENSMUSP00000104610
Gene: ENSMUSG00000031826

DomainStartEndE-ValueType
Pfam:UCH 9 113 1.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108988
AA Change: L563P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104616
Gene: ENSMUSG00000031826
AA Change: L563P

DomainStartEndE-ValueType
low complexity region 117 131 N/A INTRINSIC
low complexity region 147 155 N/A INTRINSIC
Pfam:UCH 408 786 9.3e-48 PFAM
Pfam:UCH_1 409 764 4.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134729
SMART Domains Protein: ENSMUSP00000134182
Gene: ENSMUSG00000031826

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144458
AA Change: L564P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123590
Gene: ENSMUSG00000031826
AA Change: L564P

DomainStartEndE-ValueType
Pfam:PAM2 78 95 1.1e-7 PFAM
low complexity region 118 132 N/A INTRINSIC
low complexity region 148 156 N/A INTRINSIC
Pfam:UCH 409 787 1.2e-44 PFAM
Pfam:UCH_1 410 765 4.2e-18 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin is a highly conserved protein that is covalently linked to other proteins to regulate their function and degradation. This gene encodes a member of the ubiquitin-specific protease family of cysteine proteases. The enzyme specifically cleaves ubiquitin from ubiquitin-conjugated protein substrates. The protein is found in the nucleus and cytoplasm. It functions as a co-factor of the DNA-bound androgen receptor complex, and is inhibited by a protein in the Ras-GTPase pathway. The human genome contains several pseudogenes similar to this gene. Several transcript variants, some protein-coding and others not protein-coding, have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to alterations in arsenite-induced stress granule formation, reactive oxygen species (ROS) production, and ROS-dependent apoptosis in mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
9930111J21Rik1 A G 11: 48,947,316 S815P possibly damaging Het
A430033K04Rik A G 5: 138,646,450 Y199C probably benign Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Ccdc103 T C 11: 102,882,693 F47S probably damaging Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gcc2 A G 10: 58,281,439 N1170S possibly damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kif17 A G 4: 138,274,995 Y170C probably damaging Het
Kti12 G A 4: 108,848,455 G189R probably benign Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mmp1b T C 9: 7,387,914 K27E probably benign Het
Mob4 A G 1: 55,148,429 probably null Het
Myc G A 15: 61,988,279 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Ntng2 T C 2: 29,197,090 T373A probably damaging Het
Olfr1200 C T 2: 88,767,884 V144I probably benign Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr469 T A 7: 107,823,188 T94S probably benign Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Pard3 T C 8: 127,410,747 L859P probably damaging Het
Ppcs T C 4: 119,419,088 D100G probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Pwwp2b T C 7: 139,255,987 V448A probably benign Het
Rapgef4 A G 2: 72,225,775 K624R probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim27 T A 13: 21,192,454 H457Q probably damaging Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Uspl1 T A 5: 149,214,094 D701E probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Zfp712 T C 13: 67,041,504 T320A probably benign Het
Other mutations in Usp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02000:Usp10 APN 8 119948741 missense possibly damaging 0.95
IGL02444:Usp10 APN 8 119948693 missense possibly damaging 0.70
IGL02487:Usp10 APN 8 119948775 missense probably damaging 1.00
IGL02526:Usp10 APN 8 119948775 missense probably damaging 1.00
IGL02951:Usp10 APN 8 119947086 missense probably benign 0.01
IGL03003:Usp10 APN 8 119954810 missense possibly damaging 0.90
IGL03049:Usp10 APN 8 119956627 missense probably benign 0.01
PIT4585001:Usp10 UTSW 8 119954892 missense probably benign 0.02
R0090:Usp10 UTSW 8 119953196 nonsense probably null
R0329:Usp10 UTSW 8 119936557 nonsense probably null
R0550:Usp10 UTSW 8 119947801 missense probably damaging 0.98
R2349:Usp10 UTSW 8 119956709 makesense probably null
R4345:Usp10 UTSW 8 119954814 missense probably damaging 1.00
R4782:Usp10 UTSW 8 119941191 missense probably benign 0.03
R5182:Usp10 UTSW 8 119956681 missense possibly damaging 0.95
R5184:Usp10 UTSW 8 119956681 missense possibly damaging 0.95
R5461:Usp10 UTSW 8 119956667 missense probably benign 0.44
R5749:Usp10 UTSW 8 119941133 missense probably damaging 0.99
R5873:Usp10 UTSW 8 119947092 missense possibly damaging 0.60
R5935:Usp10 UTSW 8 119947089 missense possibly damaging 0.74
R6242:Usp10 UTSW 8 119941838 missense probably benign 0.01
R6362:Usp10 UTSW 8 119941316 missense probably benign 0.00
R6608:Usp10 UTSW 8 119948422 missense probably benign 0.06
R7148:Usp10 UTSW 8 119936550 missense possibly damaging 0.47
R7164:Usp10 UTSW 8 119942108 missense probably damaging 1.00
R7238:Usp10 UTSW 8 119941544 missense probably benign
R7310:Usp10 UTSW 8 119941605 missense possibly damaging 0.89
R7792:Usp10 UTSW 8 119952001 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- ACCCACCCATGTGCAATTG -3'
(R):5'- GAGGATCCAGACACTGTCACAC -3'

Sequencing Primer
(F):5'- GGACAAATCAGGAGTCCGTTCTC -3'
(R):5'- TGTCACACCTGCCCCATGG -3'
Posted On2018-08-29