Incidental Mutation 'R6774:Pard3'
ID532289
Institutional Source Beutler Lab
Gene Symbol Pard3
Ensembl Gene ENSMUSG00000025812
Gene Namepar-3 family cell polarity regulator
SynonymsASIP, PAR-3, Pard3a, Par3, D8Ertd580e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6774 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location127063893-127612286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127410747 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 859 (L859P)
Ref Sequence ENSEMBL: ENSMUSP00000124282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026921] [ENSMUST00000079777] [ENSMUST00000159537] [ENSMUST00000160272] [ENSMUST00000160581] [ENSMUST00000160766] [ENSMUST00000161355] [ENSMUST00000162309] [ENSMUST00000162456] [ENSMUST00000162531] [ENSMUST00000162536] [ENSMUST00000162602]
Predicted Effect probably benign
Transcript: ENSMUST00000026921
SMART Domains Protein: ENSMUSP00000026921
Gene: ENSMUSG00000025812

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1.1e-72 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 3e-10 PDB
low complexity region 863 875 N/A INTRINSIC
low complexity region 892 902 N/A INTRINSIC
low complexity region 921 950 N/A INTRINSIC
low complexity region 965 1005 N/A INTRINSIC
low complexity region 1162 1200 N/A INTRINSIC
low complexity region 1264 1281 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079777
AA Change: L725P

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078710
Gene: ENSMUSG00000025812
AA Change: L725P

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
PDZ 147 226 2.34e-6 SMART
low complexity region 296 305 N/A INTRINSIC
PDZ 334 413 4.1e-20 SMART
PDZ 464 549 9.87e-14 SMART
low complexity region 636 646 N/A INTRINSIC
PDB:4DC2|Z 675 702 2e-10 PDB
low complexity region 743 755 N/A INTRINSIC
low complexity region 772 782 N/A INTRINSIC
low complexity region 801 830 N/A INTRINSIC
low complexity region 845 885 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159537
AA Change: L805P

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124934
Gene: ENSMUSG00000025812
AA Change: L805P

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 6.7e-73 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 542 627 9.87e-14 SMART
low complexity region 717 727 N/A INTRINSIC
PDB:4DC2|Z 756 783 2e-10 PDB
low complexity region 823 835 N/A INTRINSIC
low complexity region 852 862 N/A INTRINSIC
low complexity region 881 910 N/A INTRINSIC
low complexity region 925 943 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160272
AA Change: L860P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000125453
Gene: ENSMUSG00000025812
AA Change: L860P

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1.7e-60 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 4e-10 PDB
low complexity region 878 890 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 936 965 N/A INTRINSIC
low complexity region 980 1020 N/A INTRINSIC
low complexity region 1177 1215 N/A INTRINSIC
low complexity region 1279 1296 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160581
AA Change: L823P

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124141
Gene: ENSMUSG00000025812
AA Change: L823P

DomainStartEndE-ValueType
Pfam:DUF3534 4 149 7.1e-73 PFAM
low complexity region 237 249 N/A INTRINSIC
PDZ 285 364 2.34e-6 SMART
low complexity region 434 443 N/A INTRINSIC
PDZ 472 551 4.1e-20 SMART
PDZ 589 674 9.87e-14 SMART
low complexity region 764 774 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
low complexity region 870 880 N/A INTRINSIC
low complexity region 899 928 N/A INTRINSIC
low complexity region 943 983 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160766
AA Change: L773P

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124533
Gene: ENSMUSG00000025812
AA Change: L773P

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1e-72 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 542 627 9.87e-14 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
low complexity region 820 830 N/A INTRINSIC
low complexity region 849 878 N/A INTRINSIC
low complexity region 893 933 N/A INTRINSIC
low complexity region 1090 1128 N/A INTRINSIC
low complexity region 1192 1209 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161277
AA Change: L780P
SMART Domains Protein: ENSMUSP00000124789
Gene: ENSMUSG00000025812
AA Change: L780P

DomainStartEndE-ValueType
Pfam:DUF3534 3 122 9.6e-37 PFAM
PDZ 214 293 2.34e-6 SMART
low complexity region 363 372 N/A INTRINSIC
PDZ 401 480 4.1e-20 SMART
PDZ 518 603 9.87e-14 SMART
low complexity region 693 703 N/A INTRINSIC
PDB:4DC2|Z 732 759 2e-10 PDB
low complexity region 799 811 N/A INTRINSIC
low complexity region 828 838 N/A INTRINSIC
low complexity region 857 886 N/A INTRINSIC
low complexity region 901 919 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161348
AA Change: L97P
SMART Domains Protein: ENSMUSP00000123951
Gene: ENSMUSG00000025812
AA Change: L97P

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
PDB:4DC2|Z 48 75 4e-11 PDB
low complexity region 116 128 N/A INTRINSIC
low complexity region 145 155 N/A INTRINSIC
low complexity region 174 203 N/A INTRINSIC
low complexity region 218 258 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161355
AA Change: L829P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125064
Gene: ENSMUSG00000025812
AA Change: L829P

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 7.2e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 886 N/A INTRINSIC
low complexity region 905 934 N/A INTRINSIC
low complexity region 949 989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162309
AA Change: L859P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124282
Gene: ENSMUSG00000025812
AA Change: L859P

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 6.2e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 4e-10 PDB
low complexity region 877 889 N/A INTRINSIC
low complexity region 906 916 N/A INTRINSIC
low complexity region 935 964 N/A INTRINSIC
low complexity region 979 1019 N/A INTRINSIC
low complexity region 1176 1214 N/A INTRINSIC
low complexity region 1278 1295 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162456
AA Change: L725P

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124162
Gene: ENSMUSG00000025812
AA Change: L725P

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
PDZ 147 226 2.34e-6 SMART
low complexity region 296 305 N/A INTRINSIC
PDZ 334 413 4.1e-20 SMART
PDZ 464 549 9.87e-14 SMART
low complexity region 636 646 N/A INTRINSIC
PDB:4DC2|Z 675 702 2e-10 PDB
low complexity region 743 755 N/A INTRINSIC
low complexity region 772 782 N/A INTRINSIC
low complexity region 801 830 N/A INTRINSIC
low complexity region 845 885 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162531
AA Change: L820P

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125610
Gene: ENSMUSG00000025812
AA Change: L820P

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 8.4e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 586 671 9.87e-14 SMART
low complexity region 761 771 N/A INTRINSIC
low complexity region 838 850 N/A INTRINSIC
low complexity region 867 877 N/A INTRINSIC
low complexity region 896 925 N/A INTRINSIC
low complexity region 940 980 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162536
AA Change: L815P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000125212
Gene: ENSMUSG00000025812
AA Change: L815P

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1e-72 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 555 640 9.87e-14 SMART
low complexity region 727 737 N/A INTRINSIC
PDB:4DC2|Z 766 793 3e-10 PDB
low complexity region 833 845 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
low complexity region 891 920 N/A INTRINSIC
low complexity region 935 975 N/A INTRINSIC
low complexity region 1132 1170 N/A INTRINSIC
low complexity region 1234 1251 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162602
AA Change: L863P

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125450
Gene: ENSMUSG00000025812
AA Change: L863P

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 7.6e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 774 784 N/A INTRINSIC
PDB:4DC2|Z 813 840 2e-10 PDB
low complexity region 881 893 N/A INTRINSIC
low complexity region 910 920 N/A INTRINSIC
low complexity region 939 968 N/A INTRINSIC
low complexity region 983 1023 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162665
AA Change: L849P
SMART Domains Protein: ENSMUSP00000124718
Gene: ENSMUSG00000025812
AA Change: L849P

DomainStartEndE-ValueType
Pfam:DUF3534 21 166 1.4e-60 PFAM
low complexity region 254 266 N/A INTRINSIC
PDZ 302 381 2.34e-6 SMART
low complexity region 451 460 N/A INTRINSIC
PDZ 489 568 4.1e-20 SMART
PDZ 619 704 9.87e-14 SMART
low complexity region 791 801 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 897 907 N/A INTRINSIC
low complexity region 926 955 N/A INTRINSIC
low complexity region 970 1010 N/A INTRINSIC
low complexity region 1167 1205 N/A INTRINSIC
low complexity region 1269 1286 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PARD protein family. PARD family members interact with other PARD family members and other proteins; they affect asymmetrical cell division and direct polarized cell growth. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E12.5 associated with growth retardation, abnormal heart development, and abnormal epicardial cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
9930111J21Rik1 A G 11: 48,947,316 S815P possibly damaging Het
A430033K04Rik A G 5: 138,646,450 Y199C probably benign Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Ccdc103 T C 11: 102,882,693 F47S probably damaging Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gcc2 A G 10: 58,281,439 N1170S possibly damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kif17 A G 4: 138,274,995 Y170C probably damaging Het
Kti12 G A 4: 108,848,455 G189R probably benign Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mmp1b T C 9: 7,387,914 K27E probably benign Het
Mob4 A G 1: 55,148,429 probably null Het
Myc G A 15: 61,988,279 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Ntng2 T C 2: 29,197,090 T373A probably damaging Het
Olfr1200 C T 2: 88,767,884 V144I probably benign Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr469 T A 7: 107,823,188 T94S probably benign Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Ppcs T C 4: 119,419,088 D100G probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Pwwp2b T C 7: 139,255,987 V448A probably benign Het
Rapgef4 A G 2: 72,225,775 K624R probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim27 T A 13: 21,192,454 H457Q probably damaging Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp10 T C 8: 119,951,972 L564P probably benign Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Uspl1 T A 5: 149,214,094 D701E probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Zfp712 T C 13: 67,041,504 T320A probably benign Het
Other mutations in Pard3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Pard3 APN 8 127359818 splice site probably benign
IGL00484:Pard3 APN 8 127371846 missense probably benign 0.05
IGL00674:Pard3 APN 8 127388678 missense probably damaging 1.00
IGL01471:Pard3 APN 8 127378246 missense probably benign 0.01
IGL01505:Pard3 APN 8 127324063 missense probably damaging 1.00
IGL02252:Pard3 APN 8 127398756 missense probably benign 0.09
IGL02511:Pard3 APN 8 127161320 splice site probably benign
IGL02838:Pard3 APN 8 127426647 missense probably damaging 0.99
IGL02948:Pard3 APN 8 127306494 missense probably benign 0.00
IGL02987:Pard3 APN 8 127389491 missense probably damaging 0.98
IGL03037:Pard3 APN 8 127306494 missense probably benign 0.00
IGL03084:Pard3 APN 8 127593092 missense probably damaging 0.96
R0025:Pard3 UTSW 8 127161308 missense probably damaging 1.00
R0025:Pard3 UTSW 8 127161308 missense probably damaging 1.00
R0029:Pard3 UTSW 8 127426758 splice site probably benign
R0109:Pard3 UTSW 8 127398666 missense probably damaging 1.00
R0309:Pard3 UTSW 8 127376897 splice site probably benign
R0415:Pard3 UTSW 8 127610566 missense probably damaging 1.00
R0507:Pard3 UTSW 8 127371486 splice site probably benign
R1055:Pard3 UTSW 8 127378280 missense probably benign 0.34
R1305:Pard3 UTSW 8 127306410 missense possibly damaging 0.62
R1619:Pard3 UTSW 8 127380502 missense probably benign 0.02
R1855:Pard3 UTSW 8 127447812 splice site probably null
R2001:Pard3 UTSW 8 127064347 utr 5 prime probably null
R2060:Pard3 UTSW 8 127398604 missense probably benign 0.05
R2064:Pard3 UTSW 8 127610611 missense probably damaging 1.00
R2113:Pard3 UTSW 8 127388537 missense probably damaging 1.00
R2136:Pard3 UTSW 8 127376885 critical splice donor site probably null
R2224:Pard3 UTSW 8 127359776 missense probably damaging 1.00
R2252:Pard3 UTSW 8 127610599 missense probably damaging 1.00
R3870:Pard3 UTSW 8 127409686 missense probably damaging 1.00
R4154:Pard3 UTSW 8 127474396 missense probably damaging 1.00
R4212:Pard3 UTSW 8 127610458 missense probably benign 0.43
R4243:Pard3 UTSW 8 127371647 missense probably benign 0.09
R4523:Pard3 UTSW 8 127398627 missense probably benign 0.08
R4857:Pard3 UTSW 8 127324054 missense probably damaging 0.98
R4876:Pard3 UTSW 8 127561469 intron probably benign
R4877:Pard3 UTSW 8 127388537 missense probably damaging 1.00
R5197:Pard3 UTSW 8 127073290 splice site probably null
R5215:Pard3 UTSW 8 127378264 missense probably damaging 1.00
R5279:Pard3 UTSW 8 127460386 critical splice donor site probably null
R5349:Pard3 UTSW 8 127415743 missense probably damaging 1.00
R5479:Pard3 UTSW 8 127370355 missense probably damaging 1.00
R5514:Pard3 UTSW 8 127426605 missense probably damaging 1.00
R5681:Pard3 UTSW 8 127389433 missense possibly damaging 0.81
R5934:Pard3 UTSW 8 127389338 missense probably damaging 1.00
R6034:Pard3 UTSW 8 127064327 utr 5 prime probably benign
R6034:Pard3 UTSW 8 127064327 utr 5 prime probably benign
R6187:Pard3 UTSW 8 127073273 missense probably benign 0.00
R6382:Pard3 UTSW 8 127376783 missense probably damaging 1.00
R7130:Pard3 UTSW 8 127415683 missense probably damaging 1.00
R7267:Pard3 UTSW 8 127371575 missense probably damaging 0.97
R7358:Pard3 UTSW 8 127593092 missense probably damaging 0.98
R7528:Pard3 UTSW 8 127603165 missense probably damaging 1.00
R7537:Pard3 UTSW 8 127610582 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGACAAAATGACTGGCATACTG -3'
(R):5'- CCATCTGTCACACGTATTGCTG -3'

Sequencing Primer
(F):5'- ATGAAGATGCTGTTTATTCTTCTCC -3'
(R):5'- GTCACACGTATTGCTGATAAATTTC -3'
Posted On2018-08-29