Incidental Mutation 'R6774:Gcc2'
ID532298
Institutional Source Beutler Lab
Gene Symbol Gcc2
Ensembl Gene ENSMUSG00000038039
Gene NameGRIP and coiled-coil domain containing 2
Synonyms2600014C01Rik, 0610043A03Rik, 2210420P05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R6774 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location58255497-58305599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58281439 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1170 (N1170S)
Ref Sequence ENSEMBL: ENSMUSP00000054033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057659] [ENSMUST00000160416] [ENSMUST00000162041] [ENSMUST00000162860]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057659
AA Change: N1170S

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054033
Gene: ENSMUSG00000038039
AA Change: N1170S

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
coiled coil region 33 282 N/A INTRINSIC
internal_repeat_2 353 378 3.94e-5 PROSPERO
internal_repeat_2 382 406 3.94e-5 PROSPERO
coiled coil region 790 882 N/A INTRINSIC
low complexity region 939 964 N/A INTRINSIC
internal_repeat_1 1093 1111 1.93e-5 PROSPERO
low complexity region 1115 1132 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
coiled coil region 1441 1470 N/A INTRINSIC
internal_repeat_1 1554 1572 1.93e-5 PROSPERO
Grip 1608 1655 4.37e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160416
SMART Domains Protein: ENSMUSP00000123873
Gene: ENSMUSG00000038039

DomainStartEndE-ValueType
coiled coil region 37 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162041
AA Change: N1134S

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124787
Gene: ENSMUSG00000038039
AA Change: N1134S

DomainStartEndE-ValueType
coiled coil region 32 246 N/A INTRINSIC
internal_repeat_2 317 342 3.28e-5 PROSPERO
internal_repeat_2 346 370 3.28e-5 PROSPERO
coiled coil region 754 846 N/A INTRINSIC
low complexity region 903 928 N/A INTRINSIC
internal_repeat_1 1057 1075 1.6e-5 PROSPERO
low complexity region 1079 1096 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
coiled coil region 1405 1434 N/A INTRINSIC
internal_repeat_1 1518 1536 1.6e-5 PROSPERO
Grip 1572 1619 4.37e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162860
AA Change: N1070S

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124152
Gene: ENSMUSG00000038039
AA Change: N1070S

DomainStartEndE-ValueType
coiled coil region 46 182 N/A INTRINSIC
internal_repeat_2 253 278 4.17e-5 PROSPERO
internal_repeat_2 282 306 4.17e-5 PROSPERO
coiled coil region 690 782 N/A INTRINSIC
low complexity region 839 864 N/A INTRINSIC
internal_repeat_1 993 1011 2.06e-5 PROSPERO
low complexity region 1015 1032 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
coiled coil region 1341 1370 N/A INTRINSIC
internal_repeat_1 1450 1468 2.06e-5 PROSPERO
Grip 1504 1551 4.37e-19 SMART
Meta Mutation Damage Score 0.0595 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein localized to the trans-Golgi network. It is sensitive to brefeldin A. This encoded protein contains a GRIP domain which is thought to be used in targeting. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
9930111J21Rik1 A G 11: 48,947,316 S815P possibly damaging Het
A430033K04Rik A G 5: 138,646,450 Y199C probably benign Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Ccdc103 T C 11: 102,882,693 F47S probably damaging Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kif17 A G 4: 138,274,995 Y170C probably damaging Het
Kti12 G A 4: 108,848,455 G189R probably benign Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mmp1b T C 9: 7,387,914 K27E probably benign Het
Mob4 A G 1: 55,148,429 probably null Het
Myc G A 15: 61,988,279 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Ntng2 T C 2: 29,197,090 T373A probably damaging Het
Olfr1200 C T 2: 88,767,884 V144I probably benign Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr469 T A 7: 107,823,188 T94S probably benign Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Pard3 T C 8: 127,410,747 L859P probably damaging Het
Ppcs T C 4: 119,419,088 D100G probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Pwwp2b T C 7: 139,255,987 V448A probably benign Het
Rapgef4 A G 2: 72,225,775 K624R probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim27 T A 13: 21,192,454 H457Q probably damaging Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp10 T C 8: 119,951,972 L564P probably benign Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Uspl1 T A 5: 149,214,094 D701E probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Zfp712 T C 13: 67,041,504 T320A probably benign Het
Other mutations in Gcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Gcc2 APN 10 58292680 missense probably damaging 1.00
IGL00850:Gcc2 APN 10 58258248 missense probably benign 0.00
IGL00935:Gcc2 APN 10 58278779 splice site probably benign
IGL01551:Gcc2 APN 10 58298869 splice site probably benign
IGL01642:Gcc2 APN 10 58280612 missense probably benign 0.00
IGL02041:Gcc2 APN 10 58269281 missense probably damaging 1.00
IGL02215:Gcc2 APN 10 58271636 missense probably benign 0.36
IGL02448:Gcc2 APN 10 58292571 nonsense probably null
IGL02698:Gcc2 APN 10 58271290 missense possibly damaging 0.76
IGL02888:Gcc2 APN 10 58294828 missense probably damaging 1.00
IGL02936:Gcc2 APN 10 58296140 missense probably damaging 1.00
IGL03223:Gcc2 APN 10 58298734 missense probably damaging 1.00
IGL03249:Gcc2 APN 10 58270992 nonsense probably null
R0179:Gcc2 UTSW 10 58276650 missense probably benign 0.39
R0528:Gcc2 UTSW 10 58298689 missense probably damaging 1.00
R1569:Gcc2 UTSW 10 58270171 missense probably benign 0.00
R1606:Gcc2 UTSW 10 58269448 missense probably damaging 1.00
R1725:Gcc2 UTSW 10 58304115 missense possibly damaging 0.95
R1916:Gcc2 UTSW 10 58276663 missense probably damaging 1.00
R1956:Gcc2 UTSW 10 58286143 missense possibly damaging 0.66
R2058:Gcc2 UTSW 10 58285957 missense probably benign 0.10
R2114:Gcc2 UTSW 10 58269540 nonsense probably null
R2280:Gcc2 UTSW 10 58269680 missense probably benign 0.38
R2435:Gcc2 UTSW 10 58294780 missense probably damaging 1.00
R2876:Gcc2 UTSW 10 58290302 missense probably damaging 0.99
R4753:Gcc2 UTSW 10 58290382 missense probably benign 0.20
R4827:Gcc2 UTSW 10 58286131 critical splice acceptor site probably null
R4911:Gcc2 UTSW 10 58270439 missense probably damaging 1.00
R5033:Gcc2 UTSW 10 58278806 missense probably damaging 0.98
R5224:Gcc2 UTSW 10 58286160 missense probably damaging 1.00
R5271:Gcc2 UTSW 10 58269695 missense possibly damaging 0.46
R5398:Gcc2 UTSW 10 58269507 missense probably benign 0.00
R5411:Gcc2 UTSW 10 58270969 missense probably damaging 0.99
R5594:Gcc2 UTSW 10 58287242 missense probably damaging 0.99
R5825:Gcc2 UTSW 10 58294821 missense probably damaging 1.00
R5974:Gcc2 UTSW 10 58258243 missense probably damaging 0.99
R5987:Gcc2 UTSW 10 58255847 utr 5 prime probably benign
R6195:Gcc2 UTSW 10 58270984 missense probably damaging 0.96
R6198:Gcc2 UTSW 10 58292590 missense probably benign 0.26
R6233:Gcc2 UTSW 10 58270984 missense probably damaging 0.96
R6331:Gcc2 UTSW 10 58271465 missense probably benign
R6349:Gcc2 UTSW 10 58269474 missense probably benign 0.01
R6593:Gcc2 UTSW 10 58271507 missense probably damaging 1.00
R6632:Gcc2 UTSW 10 58270049 unclassified probably null
R6647:Gcc2 UTSW 10 58287281 critical splice donor site probably null
R6808:Gcc2 UTSW 10 58258242 missense probably damaging 0.99
R7072:Gcc2 UTSW 10 58270927 missense probably benign 0.02
R7220:Gcc2 UTSW 10 58280594 missense probably benign 0.00
R7352:Gcc2 UTSW 10 58280698 critical splice donor site probably null
R7384:Gcc2 UTSW 10 58269964 missense probably damaging 1.00
R7439:Gcc2 UTSW 10 58256901 missense probably benign 0.08
R7441:Gcc2 UTSW 10 58256901 missense probably benign 0.08
R7543:Gcc2 UTSW 10 58271264 missense probably benign 0.02
R7843:Gcc2 UTSW 10 58268021 missense possibly damaging 0.77
R7850:Gcc2 UTSW 10 58278881 missense probably damaging 0.96
R8336:Gcc2 UTSW 10 58272367 missense probably damaging 0.99
X0018:Gcc2 UTSW 10 58278814 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAACCTGCTTGTTCCTGTGG -3'
(R):5'- CACATGTGCTGGTGATTAAACC -3'

Sequencing Primer
(F):5'- GCGTGGTTAAAGCAGTTCC -3'
(R):5'- AGACTACACATGCCTGTAGACTCTTG -3'
Posted On2018-08-29