Incidental Mutation 'R6774:9930111J21Rik1'
ID532300
Institutional Source Beutler Lab
Gene Symbol 9930111J21Rik1
Ensembl Gene ENSMUSG00000069893
Gene NameRIKEN cDNA 9930111J21 gene 1
Synonyms9930111J21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6774 (G1)
Quality Score185.009
Status Not validated
Chromosome11
Chromosomal Location48946150-48979398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48947316 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 815 (S815P)
Ref Sequence ENSEMBL: ENSMUSP00000095102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059930] [ENSMUST00000097494] [ENSMUST00000104958]
Predicted Effect probably benign
Transcript: ENSMUST00000059930
SMART Domains Protein: ENSMUSP00000054351
Gene: ENSMUSG00000048852

DomainStartEndE-ValueType
Pfam:IIGP 27 389 8.4e-123 PFAM
Pfam:MMR_HSR1 63 190 2.2e-9 PFAM
low complexity region 421 432 N/A INTRINSIC
Pfam:IIGP 438 811 3.4e-152 PFAM
Pfam:MMR_HSR1 474 632 1.4e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097494
AA Change: S815P

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095102
Gene: ENSMUSG00000069893
AA Change: S815P

DomainStartEndE-ValueType
Pfam:IIGP 36 398 2e-125 PFAM
Pfam:DLIC 52 107 3.2e-5 PFAM
Pfam:MMR_HSR1 72 235 2e-11 PFAM
low complexity region 430 444 N/A INTRINSIC
Pfam:IIGP 447 820 1.9e-153 PFAM
Pfam:MMR_HSR1 483 611 3.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000104958
SMART Domains Protein: ENSMUSP00000100564
Gene: ENSMUSG00000078153

DomainStartEndE-ValueType
Pfam:PA28_alpha 11 71 1.2e-26 PFAM
Pfam:PA28_beta 93 237 5.3e-58 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
A430033K04Rik A G 5: 138,646,450 Y199C probably benign Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Ccdc103 T C 11: 102,882,693 F47S probably damaging Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gcc2 A G 10: 58,281,439 N1170S possibly damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kif17 A G 4: 138,274,995 Y170C probably damaging Het
Kti12 G A 4: 108,848,455 G189R probably benign Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mmp1b T C 9: 7,387,914 K27E probably benign Het
Mob4 A G 1: 55,148,429 probably null Het
Myc G A 15: 61,988,279 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Ntng2 T C 2: 29,197,090 T373A probably damaging Het
Olfr1200 C T 2: 88,767,884 V144I probably benign Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr469 T A 7: 107,823,188 T94S probably benign Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Pard3 T C 8: 127,410,747 L859P probably damaging Het
Ppcs T C 4: 119,419,088 D100G probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Pwwp2b T C 7: 139,255,987 V448A probably benign Het
Rapgef4 A G 2: 72,225,775 K624R probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim27 T A 13: 21,192,454 H457Q probably damaging Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp10 T C 8: 119,951,972 L564P probably benign Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Uspl1 T A 5: 149,214,094 D701E probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Zfp712 T C 13: 67,041,504 T320A probably benign Het
Other mutations in 9930111J21Rik1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:9930111J21Rik1 APN 11 48948212 missense possibly damaging 0.66
IGL02189:9930111J21Rik1 APN 11 48947421 missense probably benign 0.09
IGL02554:9930111J21Rik1 APN 11 48948003 missense probably damaging 1.00
IGL03172:9930111J21Rik1 APN 11 48948176 missense probably damaging 1.00
IGL03334:9930111J21Rik1 APN 11 48947475 missense probably benign 0.09
R0502:9930111J21Rik1 UTSW 11 48947495 missense possibly damaging 0.69
R0503:9930111J21Rik1 UTSW 11 48947495 missense possibly damaging 0.69
R2023:9930111J21Rik1 UTSW 11 48948420 missense possibly damaging 0.51
R3704:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3705:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3714:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3715:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3961:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3962:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R4867:9930111J21Rik1 UTSW 11 48948548 critical splice acceptor site probably null
R5033:9930111J21Rik1 UTSW 11 48947706 missense probably damaging 1.00
R5159:9930111J21Rik1 UTSW 11 48948525 missense probably benign 0.06
R6567:9930111J21Rik1 UTSW 11 48948123 missense probably benign 0.26
R7730:9930111J21Rik1 UTSW 11 48947876 missense probably benign 0.19
R7863:9930111J21Rik1 UTSW 11 48947274 missense probably benign 0.18
X0067:9930111J21Rik1 UTSW 11 48948042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCTCCCAGAAAATGTTTGC -3'
(R):5'- TCACTGGAAAACATTGCCAAGG -3'

Sequencing Primer
(F):5'- CCCAGAAAATGTTTGCTGCTTAAAAG -3'
(R):5'- TGCCAAGGATTTCAATGTGTC -3'
Posted On2018-08-29