Incidental Mutation 'R6774:Ccdc103'
ID532301
Institutional Source Beutler Lab
Gene Symbol Ccdc103
Ensembl Gene ENSMUSG00000020930
Gene Namecoiled-coil domain containing 103
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6774 (G1)
Quality Score221.009
Status Validated
Chromosome11
Chromosomal Location102881204-102885216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102882693 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 47 (F47S)
Ref Sequence ENSEMBL: ENSMUSP00000125214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021306] [ENSMUST00000021307] [ENSMUST00000067444] [ENSMUST00000100369] [ENSMUST00000107060] [ENSMUST00000159834] [ENSMUST00000173679]
Predicted Effect probably benign
Transcript: ENSMUST00000021306
SMART Domains Protein: ENSMUSP00000021306
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
Pfam:EFTUD2 3 110 1.1e-42 PFAM
Pfam:GTP_EFTU 127 440 9.6e-47 PFAM
Pfam:GTP_EFTU_D2 489 566 3.8e-15 PFAM
Pfam:EFG_II 584 656 9.9e-11 PFAM
EFG_IV 703 824 1.1e-16 SMART
EFG_C 826 915 1.14e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000021307
AA Change: F47S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021307
Gene: ENSMUSG00000020930
AA Change: F47S

DomainStartEndE-ValueType
Pfam:Dynein_attach_N 7 74 3.3e-32 PFAM
Pfam:RPAP3_C 98 188 1.2e-19 PFAM
low complexity region 219 233 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067444
SMART Domains Protein: ENSMUSP00000064691
Gene: ENSMUSG00000020932

DomainStartEndE-ValueType
Pfam:Filament_head 2 64 1.7e-8 PFAM
Filament 65 373 2.34e-136 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100369
SMART Domains Protein: ENSMUSP00000097938
Gene: ENSMUSG00000075510

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 39 142 3.73e0 SMART
IG_like 275 361 1.61e1 SMART
transmembrane domain 377 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107060
SMART Domains Protein: ENSMUSP00000102675
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
Pfam:GTP_EFTU 126 439 9.6e-44 PFAM
Pfam:Miro 130 260 2.5e-6 PFAM
Pfam:GTP_EFTU_D2 488 565 7.9e-13 PFAM
Pfam:EFG_II 583 655 8.2e-10 PFAM
EFG_IV 702 823 1.1e-16 SMART
EFG_C 825 914 1.14e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159834
AA Change: F47S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125214
Gene: ENSMUSG00000020930
AA Change: F47S

DomainStartEndE-ValueType
coiled coil region 8 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173679
SMART Domains Protein: ENSMUSP00000134327
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 29 51 N/A INTRINSIC
Pfam:GTP_EFTU 127 430 2.2e-36 PFAM
Pfam:GTP_EFTU_D2 479 556 7.8e-13 PFAM
Pfam:EFG_II 574 646 8.1e-10 PFAM
EFG_IV 693 814 1.1e-16 SMART
EFG_C 816 905 1.14e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a coiled-coil domain. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
9930111J21Rik1 A G 11: 48,947,316 S815P possibly damaging Het
A430033K04Rik A G 5: 138,646,450 Y199C probably benign Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gcc2 A G 10: 58,281,439 N1170S possibly damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kif17 A G 4: 138,274,995 Y170C probably damaging Het
Kti12 G A 4: 108,848,455 G189R probably benign Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mmp1b T C 9: 7,387,914 K27E probably benign Het
Mob4 A G 1: 55,148,429 probably null Het
Myc G A 15: 61,988,279 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Ntng2 T C 2: 29,197,090 T373A probably damaging Het
Olfr1200 C T 2: 88,767,884 V144I probably benign Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr469 T A 7: 107,823,188 T94S probably benign Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Pard3 T C 8: 127,410,747 L859P probably damaging Het
Ppcs T C 4: 119,419,088 D100G probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Pwwp2b T C 7: 139,255,987 V448A probably benign Het
Rapgef4 A G 2: 72,225,775 K624R probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim27 T A 13: 21,192,454 H457Q probably damaging Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp10 T C 8: 119,951,972 L564P probably benign Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Uspl1 T A 5: 149,214,094 D701E probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Zfp712 T C 13: 67,041,504 T320A probably benign Het
Other mutations in Ccdc103
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1909:Ccdc103 UTSW 11 102882566 missense probably benign 0.20
R4073:Ccdc103 UTSW 11 102884099 missense probably damaging 1.00
R5000:Ccdc103 UTSW 11 102884106 missense probably benign 0.00
R5729:Ccdc103 UTSW 11 102883078 missense probably damaging 1.00
R6552:Ccdc103 UTSW 11 102884144 missense probably benign 0.01
R7115:Ccdc103 UTSW 11 102883810 missense possibly damaging 0.92
X0026:Ccdc103 UTSW 11 102882582 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCTCTGCTGACATGCATTC -3'
(R):5'- CAGCATCTTTCAGGCCATAAC -3'

Sequencing Primer
(F):5'- GCTGACATGCATTCTTCTTGC -3'
(R):5'- AGCATCTTTCAGGCCATAACTCATG -3'
Posted On2018-08-29