Mutagenetix > Incidental Mutations

Incidental Mutation 'R6774:Ahnak2'

532302

Institutional Source

Beutler Lab

Gene Symbol

Ahnak2

Ensembl Gene

ENSMUSG00000072812

Gene Name

AHNAK nucleoprotein 2

Synonyms

LOC382643

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R6774 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

112772194-112802657 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 112773738 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 494 (C494Y)

Ref Sequence

ENSEMBL: ENSMUSP00000098572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063888] [ENSMUST00000101010] [ENSMUST00000128258]

Predicted Effect

probably benign
Transcript: ENSMUST00000063888

SMART Domains

Protein: ENSMUSP00000067002
Gene: ENSMUSG00000052160

Domain	Start	End	E-Value	Type
transmembrane domain	35	57	N/A	INTRINSIC
low complexity region	113	124	N/A	INTRINSIC
PLDc	207	234	1.64e-10	SMART
Pfam:PLDc_3	237	414	5.5e-41	PFAM
PLDc	421	447	4.66e-6	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101010
AA Change: C494Y

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000098572
Gene: ENSMUSG00000072812
AA Change: C494Y

Domain	Start	End	E-Value	Type
low complexity region	5	14	N/A	INTRINSIC
low complexity region	364	375	N/A	INTRINSIC
low complexity region	545	564	N/A	INTRINSIC
low complexity region	717	733	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000128258
AA Change: C1300Y

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000122404
Gene: ENSMUSG00000072812
AA Change: C1300Y

Domain	Start	End	E-Value	Type
low complexity region	5	66	N/A	INTRINSIC
internal_repeat_1	67	251	2.35e-83	PROSPERO
low complexity region	285	308	N/A	INTRINSIC
low complexity region	371	389	N/A	INTRINSIC
internal_repeat_1	413	597	2.35e-83	PROSPERO
low complexity region	734	756	N/A	INTRINSIC
low complexity region	811	820	N/A	INTRINSIC
low complexity region	1170	1181	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1523	1539	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137195

SMART Domains

Protein: ENSMUSP00000116582
Gene: ENSMUSG00000072812

Domain	Start	End	E-Value	Type
internal_repeat_1	2	521	3.81e-221	PROSPERO
low complexity region	557	569	N/A	INTRINSIC
internal_repeat_1	606	1126	3.81e-221	PROSPERO

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

98% (53/54)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	A	T	9: 57,256,625	I822N	probably damaging	Het
9930111J21Rik1	A	G	11: 48,947,316	S815P	possibly damaging	Het
A430033K04Rik	A	G	5: 138,646,450	Y199C	probably benign	Het
Afap1l1	A	T	18: 61,755,661	V113E	probably benign	Het
Atr	A	T	9: 95,927,213	E1981D	probably benign	Het
Bmp7	A	G	2: 172,872,958	Y353H	probably damaging	Het
Capn11	C	T	17: 45,657,330		probably benign	Het
Ccdc103	T	C	11: 102,882,693	F47S	probably damaging	Het
Cmas	A	G	6: 142,764,421	Y130C	possibly damaging	Het
Cntn5	T	C	9: 10,144,217	Y149C	probably damaging	Het
Col12a1	A	C	9: 79,706,337	S75R	possibly damaging	Het
Crat	G	A	2: 30,413,183	H31Y	probably damaging	Het
Dnah7a	A	G	1: 53,698,651	V41A	probably benign	Het
F5	C	T	1: 164,186,878	R573C	probably damaging	Het
Gcc2	A	G	10: 58,281,439	N1170S	possibly damaging	Het
Gm29666	A	T	15: 84,914,059	C100*	probably null	Het
Gm3573	A	T	14: 42,187,515	Y158N	possibly damaging	Het
Gm5346	T	A	8: 43,625,183	H668L	probably benign	Het
Gm597	A	T	1: 28,776,893	I686N	probably benign	Het
Gtf3c1	G	T	7: 125,641,621	A1968E	possibly damaging	Het
Heg1	C	A	16: 33,738,268	T815K	probably damaging	Het
Herc1	TCCC	TCC	9: 66,501,188		probably null	Het
Kif17	A	G	4: 138,274,995	Y170C	probably damaging	Het
Kti12	G	A	4: 108,848,455	G189R	probably benign	Het
Lrp4	G	A	2: 91,511,504	A1821T	probably benign	Het
Mamdc4	T	C	2: 25,566,936	I610V	probably benign	Het
Mmp1b	T	C	9: 7,387,914	K27E	probably benign	Het
Mob4	A	G	1: 55,148,429		probably null	Het
Myc	G	A	15: 61,988,279		probably null	Het
Myo5c	A	T	9: 75,289,186	I1305F	probably benign	Het
Nprl3	A	G	11: 32,237,381	V292A	probably damaging	Het
Ntng2	T	C	2: 29,197,090	T373A	probably damaging	Het
Olfr1200	C	T	2: 88,767,884	V144I	probably benign	Het
Olfr161	T	A	16: 3,592,516	V40D	probably damaging	Het
Olfr469	T	A	7: 107,823,188	T94S	probably benign	Het
Olfr863-ps1	A	T	9: 19,941,774	L222H	unknown	Het
Pard3	T	C	8: 127,410,747	L859P	probably damaging	Het
Ppcs	T	C	4: 119,419,088	D100G	probably damaging	Het
Prkdc	G	T	16: 15,725,461		probably null	Het
Pwwp2b	T	C	7: 139,255,987	V448A	probably benign	Het
Rapgef4	A	G	2: 72,225,775	K624R	probably benign	Het
Synj2	C	T	17: 6,038,015	S1447L	possibly damaging	Het
Tfap2a	T	A	13: 40,728,754	N25I	probably damaging	Het
Tnxb	C	A	17: 34,709,632	Y2673*	probably null	Het
Trim27	T	A	13: 21,192,454	H457Q	probably damaging	Het
Trim72	T	G	7: 128,010,386	F453L	probably damaging	Het
Ubr5	A	T	15: 38,015,135	M877K	probably damaging	Het
Usp10	T	C	8: 119,951,972	L564P	probably benign	Het
Usp54	A	G	14: 20,577,228	V454A	probably damaging	Het
Uspl1	T	A	5: 149,214,094	D701E	probably benign	Het
Vmn2r103	A	G	17: 19,773,511	H50R	probably benign	Het
Zfp35	G	A	18: 24,002,958	V120I	possibly damaging	Het
Zfp712	T	C	13: 67,041,504	T320A	probably benign	Het

Other mutations in Ahnak2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02257:Ahnak2	APN	12	112785285	missense	possibly damaging	0.79
IGL02994:Ahnak2	APN	12	112786207	missense	probably damaging	0.99
PIT4480001:Ahnak2	UTSW	12	112773924	missense	possibly damaging	0.79
PIT4810001:Ahnak2	UTSW	12	112785594	missense
R0025:Ahnak2	UTSW	12	112785534	missense	probably damaging	0.99
R0025:Ahnak2	UTSW	12	112785534	missense	probably damaging	0.99
R0038:Ahnak2	UTSW	12	112774462	missense	probably benign	0.00
R0125:Ahnak2	UTSW	12	112785156	missense	probably benign	0.41
R1173:Ahnak2	UTSW	12	112785789	missense	probably damaging	1.00
R1494:Ahnak2	UTSW	12	112787950	missense	probably damaging	1.00
R1712:Ahnak2	UTSW	12	112785378	missense	probably benign	0.05
R1888:Ahnak2	UTSW	12	112773891	missense	possibly damaging	0.49
R1888:Ahnak2	UTSW	12	112773891	missense	possibly damaging	0.49
R2042:Ahnak2	UTSW	12	112785819	missense	probably damaging	0.98
R2056:Ahnak2	UTSW	12	112785006	missense	probably benign	0.00
R2417:Ahnak2	UTSW	12	112775371	missense	probably damaging	1.00
R2762:Ahnak2	UTSW	12	112785364	missense	probably damaging	0.96
R3618:Ahnak2	UTSW	12	112786222	missense	probably damaging	1.00
R3706:Ahnak2	UTSW	12	112773651	missense	possibly damaging	0.74
R3739:Ahnak2	UTSW	12	112774558	missense	probably benign	0.05
R3950:Ahnak2	UTSW	12	112785789	missense	probably damaging	1.00
R4485:Ahnak2	UTSW	12	112779767	unclassified	probably benign
R4651:Ahnak2	UTSW	12	112774837	missense	possibly damaging	0.93
R4652:Ahnak2	UTSW	12	112774837	missense	possibly damaging	0.93
R4831:Ahnak2	UTSW	12	112775749	missense	probably damaging	0.99
R4836:Ahnak2	UTSW	12	112774116	missense	probably damaging	1.00
R4837:Ahnak2	UTSW	12	112785739	missense	probably benign	0.00
R4864:Ahnak2	UTSW	12	112773606	missense	probably damaging	0.98
R4908:Ahnak2	UTSW	12	112775272	missense	probably benign	0.00
R5067:Ahnak2	UTSW	12	112785316	missense	probably benign	0.01
R5146:Ahnak2	UTSW	12	112775726	missense	probably benign	0.00
R5228:Ahnak2	UTSW	12	112775386	missense	probably benign	0.03
R5255:Ahnak2	UTSW	12	112773378	missense	possibly damaging	0.92
R5323:Ahnak2	UTSW	12	112779812	unclassified	probably benign
R5523:Ahnak2	UTSW	12	112775208	missense	probably damaging	1.00
R5733:Ahnak2	UTSW	12	112775666	nonsense	probably null
R5799:Ahnak2	UTSW	12	112778930	unclassified	probably benign
R5817:Ahnak2	UTSW	12	112774003	missense	probably damaging	1.00
R5835:Ahnak2	UTSW	12	112775796	missense	possibly damaging	0.66
R6083:Ahnak2	UTSW	12	112782612	missense	probably benign	0.06
R6083:Ahnak2	UTSW	12	112782999	missense	probably benign	0.01
R6167:Ahnak2	UTSW	12	112783122	missense	probably benign	0.03
R6168:Ahnak2	UTSW	12	112783122	missense	probably benign	0.03
R6405:Ahnak2	UTSW	12	112773337	missense	probably damaging	1.00
R6460:Ahnak2	UTSW	12	112786990	missense	probably null	0.27
R6495:Ahnak2	UTSW	12	112773714	missense	probably damaging	1.00
R6544:Ahnak2	UTSW	12	112780652	unclassified	probably benign
R6656:Ahnak2	UTSW	12	112785371	missense	probably benign	0.02
R6679:Ahnak2	UTSW	12	112772976	missense	probably damaging	1.00
R6723:Ahnak2	UTSW	12	112778793	missense	probably damaging	1.00
R6884:Ahnak2	UTSW	12	112775429	missense	possibly damaging	0.81
R6906:Ahnak2	UTSW	12	112785313	missense	probably benign	0.00
R6919:Ahnak2	UTSW	12	112774684	missense	possibly damaging	0.55
R7036:Ahnak2	UTSW	12	112778781	unclassified	probably benign
R7037:Ahnak2	UTSW	12	112774278	missense	probably damaging	0.99
R7064:Ahnak2	UTSW	12	112780742	unclassified	probably benign
R7072:Ahnak2	UTSW	12	112788166	missense
R7112:Ahnak2	UTSW	12	112783119	missense
R7268:Ahnak2	UTSW	12	112780802	missense
R7269:Ahnak2	UTSW	12	112780802	missense
R7270:Ahnak2	UTSW	12	112780802	missense
R7271:Ahnak2	UTSW	12	112780802	missense
R7444:Ahnak2	UTSW	12	112781208	missense
R7448:Ahnak2	UTSW	12	112782502	missense
R7488:Ahnak2	UTSW	12	112785021	missense
R7508:Ahnak2	UTSW	12	112774405	missense	possibly damaging	0.46
R7560:Ahnak2	UTSW	12	112779674	missense
R7611:Ahnak2	UTSW	12	112788129	missense
R7743:Ahnak2	UTSW	12	112784763	missense	not run
R7762:Ahnak2	UTSW	12	112775680	missense	probably benign	0.27
R7780:Ahnak2	UTSW	12	112782613	missense
R7930:Ahnak2	UTSW	12	112779125	missense
R7985:Ahnak2	UTSW	12	112778963	missense
R8114:Ahnak2	UTSW	12	112774729	missense	probably benign	0.05
R8122:Ahnak2	UTSW	12	112776076	missense	possibly damaging	0.83
R8240:Ahnak2	UTSW	12	112774648	missense	probably benign	0.03
R8289:Ahnak2	UTSW	12	112775808	missense	possibly damaging	0.46
R8315:Ahnak2	UTSW	12	112781133	missense
R8430:Ahnak2	UTSW	12	112774687	missense	possibly damaging	0.86
Z1177:Ahnak2	UTSW	12	112781199	missense

Predicted Primers

PCR Primer
(F):5'- TGGTTCGCCAGTATCAGGTG -3'
(R):5'- ATTCTAAAGACAGGCGCCG -3'

Sequencing Primer
(F):5'- CTCAGCAGGAGCAGAGTGTC -3'
(R):5'- CGCCGAGGACACCAGAATG -3'

Posted On

2018-08-29