Incidental Mutation 'R6774:Myc'
ID532309
Institutional Source Beutler Lab
Gene Symbol Myc
Ensembl Gene ENSMUSG00000022346
Gene Namemyelocytomatosis oncogene
SynonymsNird, Myc2, Niard, c-myc, bHLHe39
MMRRC Submission
Accession Numbers

VEGA: OTTMUSP00000048877; MGI: 97250

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6774 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location61985391-61990374 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 61988279 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022971] [ENSMUST00000159327] [ENSMUST00000159338] [ENSMUST00000160009] [ENSMUST00000161976] [ENSMUST00000167731] [ENSMUST00000188482] [ENSMUST00000191178]
Predicted Effect probably null
Transcript: ENSMUST00000022971
SMART Domains Protein: ENSMUSP00000022971
Gene: ENSMUSG00000022346

DomainStartEndE-ValueType
Pfam:Myc_N 16 360 7e-118 PFAM
HLH 375 427 2.3e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159327
SMART Domains Protein: ENSMUSP00000124758
Gene: ENSMUSG00000022346

DomainStartEndE-ValueType
Pfam:Myc_N 1 345 1.4e-141 PFAM
HLH 360 412 2.3e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159338
Predicted Effect probably null
Transcript: ENSMUST00000160009
SMART Domains Protein: ENSMUSP00000123852
Gene: ENSMUSG00000022346

DomainStartEndE-ValueType
Pfam:Myc_N 1 345 1.4e-141 PFAM
HLH 360 412 2.3e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000161976
SMART Domains Protein: ENSMUSP00000123821
Gene: ENSMUSG00000022346

DomainStartEndE-ValueType
Pfam:Myc_N 1 345 1.4e-141 PFAM
HLH 360 412 2.3e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167731
SMART Domains Protein: ENSMUSP00000130285
Gene: ENSMUSG00000022346

DomainStartEndE-ValueType
Pfam:Myc_N 15 359 1.5e-141 PFAM
HLH 374 426 2.3e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188482
SMART Domains Protein: ENSMUSP00000140183
Gene: ENSMUSG00000022346

DomainStartEndE-ValueType
Pfam:Myc_N 16 360 1.5e-141 PFAM
HLH 375 427 2.3e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191178
SMART Domains Protein: ENSMUSP00000141139
Gene: ENSMUSG00000022346

DomainStartEndE-ValueType
Pfam:Myc_N 15 359 1.9e-141 PFAM
HLH 374 426 2.3e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: The protein encoded by this gene is a multifunctional, nuclear phosphoprotein that plays a role in cell cycle progression, apoptosis and cellular transformation. It functions as a transcription factor that regulates transcription of specific target genes. Mutations, overexpression, rearrangement and translocation of this gene have been associated with a variety of hematopoietic tumors, leukemias and lymphomas, including Burkitt lymphoma, in human. There is evidence to show that alternative translation initiations from an upstream, in-frame non-AUG (CUG) and a downstream AUG start site result in the production of two isoforms with distinct N-termini, in human and mouse. Under conditions of stress, such as high cell densities and methionine deprivation, there is a specific and dramatic increase in the synthesis of the non-AUG initiated protein, suggesting its importance in times of adversity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mutations affect growth and development of heart, pericardium, neural tube, vasculogenesis and erythropoeisis. Homozygous null mutants die by embryonic day 10.5. Heterozygotes have reduced body size and multiorgan hypoplasia; females have small litters. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted(19) Gene trapped(4)          

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,625 I822N probably damaging Het
9930111J21Rik1 A G 11: 48,947,316 S815P possibly damaging Het
A430033K04Rik A G 5: 138,646,450 Y199C probably benign Het
Afap1l1 A T 18: 61,755,661 V113E probably benign Het
Ahnak2 C T 12: 112,773,738 C494Y possibly damaging Het
Atr A T 9: 95,927,213 E1981D probably benign Het
Bmp7 A G 2: 172,872,958 Y353H probably damaging Het
Capn11 C T 17: 45,657,330 probably benign Het
Ccdc103 T C 11: 102,882,693 F47S probably damaging Het
Cmas A G 6: 142,764,421 Y130C possibly damaging Het
Cntn5 T C 9: 10,144,217 Y149C probably damaging Het
Col12a1 A C 9: 79,706,337 S75R possibly damaging Het
Crat G A 2: 30,413,183 H31Y probably damaging Het
Dnah7a A G 1: 53,698,651 V41A probably benign Het
F5 C T 1: 164,186,878 R573C probably damaging Het
Gcc2 A G 10: 58,281,439 N1170S possibly damaging Het
Gm29666 A T 15: 84,914,059 C100* probably null Het
Gm3573 A T 14: 42,187,515 Y158N possibly damaging Het
Gm5346 T A 8: 43,625,183 H668L probably benign Het
Gm597 A T 1: 28,776,893 I686N probably benign Het
Gtf3c1 G T 7: 125,641,621 A1968E possibly damaging Het
Heg1 C A 16: 33,738,268 T815K probably damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Kif17 A G 4: 138,274,995 Y170C probably damaging Het
Kti12 G A 4: 108,848,455 G189R probably benign Het
Lrp4 G A 2: 91,511,504 A1821T probably benign Het
Mamdc4 T C 2: 25,566,936 I610V probably benign Het
Mmp1b T C 9: 7,387,914 K27E probably benign Het
Mob4 A G 1: 55,148,429 probably null Het
Myo5c A T 9: 75,289,186 I1305F probably benign Het
Nprl3 A G 11: 32,237,381 V292A probably damaging Het
Ntng2 T C 2: 29,197,090 T373A probably damaging Het
Olfr1200 C T 2: 88,767,884 V144I probably benign Het
Olfr161 T A 16: 3,592,516 V40D probably damaging Het
Olfr469 T A 7: 107,823,188 T94S probably benign Het
Olfr863-ps1 A T 9: 19,941,774 L222H unknown Het
Pard3 T C 8: 127,410,747 L859P probably damaging Het
Ppcs T C 4: 119,419,088 D100G probably damaging Het
Prkdc G T 16: 15,725,461 probably null Het
Pwwp2b T C 7: 139,255,987 V448A probably benign Het
Rapgef4 A G 2: 72,225,775 K624R probably benign Het
Synj2 C T 17: 6,038,015 S1447L possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tnxb C A 17: 34,709,632 Y2673* probably null Het
Trim27 T A 13: 21,192,454 H457Q probably damaging Het
Trim72 T G 7: 128,010,386 F453L probably damaging Het
Ubr5 A T 15: 38,015,135 M877K probably damaging Het
Usp10 T C 8: 119,951,972 L564P probably benign Het
Usp54 A G 14: 20,577,228 V454A probably damaging Het
Uspl1 T A 5: 149,214,094 D701E probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Zfp35 G A 18: 24,002,958 V120I possibly damaging Het
Zfp712 T C 13: 67,041,504 T320A probably benign Het
Other mutations in Myc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Myc APN 15 61989820 missense probably benign 0.03
IGL02372:Myc APN 15 61987858 missense probably damaging 1.00
IGL02400:Myc APN 15 61989911 unclassified probably benign
IGL02677:Myc APN 15 61989664 missense probably damaging 1.00
IGL02834:Myc APN 15 61987666 missense probably damaging 1.00
IGL03330:Myc APN 15 61988149 missense probably benign
PIT1430001:Myc UTSW 15 61987693 missense probably damaging 1.00
R1245:Myc UTSW 15 61987897 missense probably damaging 0.96
R2105:Myc UTSW 15 61988102 missense probably damaging 1.00
R4373:Myc UTSW 15 61989664 missense probably damaging 0.99
R6813:Myc UTSW 15 61988152 missense probably damaging 1.00
R7371:Myc UTSW 15 61988182 missense probably damaging 0.97
R8376:Myc UTSW 15 61987546 missense possibly damaging 0.94
RF020:Myc UTSW 15 61985823 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGTGCATTGACCCCTCAGTG -3'
(R):5'- CCCAGGGTAATTAAAATGCTTAGG -3'

Sequencing Primer
(F):5'- ATTGACCCCTCAGTGGTCTTTC -3'
(R):5'- CCCAAATGAAATTCCTGAGGGGTG -3'
Posted On2018-08-29