Incidental Mutation 'R6775:Plscr4'
ID532335
Institutional Source Beutler Lab
Gene Symbol Plscr4
Ensembl Gene ENSMUSG00000032377
Gene Namephospholipid scramblase 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6775 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location92457373-92492456 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 92482805 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 94 (M94I)
Ref Sequence ENSEMBL: ENSMUSP00000034941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034941]
Predicted Effect probably benign
Transcript: ENSMUST00000034941
AA Change: M94I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034941
Gene: ENSMUSG00000032377
AA Change: M94I

DomainStartEndE-ValueType
low complexity region 38 51 N/A INTRINSIC
Pfam:Scramblase 96 318 7.5e-87 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 G A 13: 104,313,652 V289M probably damaging Het
Atp10b A G 11: 43,222,213 D862G possibly damaging Het
Colec10 A G 15: 54,435,023 E60G possibly damaging Het
Cpne1 A G 2: 156,078,420 V179A probably damaging Het
E130309D02Rik C A 5: 143,311,738 V185L probably benign Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gmip A G 8: 69,815,635 D423G possibly damaging Het
Klk1b24 A G 7: 44,191,465 M106V probably benign Het
Olfr1090 G A 2: 86,754,577 R54C probably damaging Het
Olfr292 A G 7: 86,695,149 E231G probably benign Het
Olfr849 A T 9: 19,441,422 T170S possibly damaging Het
Orc1 T A 4: 108,603,455 F496I probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Phf11b A T 14: 59,338,645 N47K probably benign Het
Ppip5k2 A T 1: 97,719,860 V1047E possibly damaging Het
Scn3a A G 2: 65,521,815 Y384H possibly damaging Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Smc1b T C 15: 85,089,680 E925G probably damaging Het
Sorl1 A G 9: 42,092,452 Y183H possibly damaging Het
Tarbp1 A C 8: 126,436,829 D1151E probably benign Het
Vmn2r3 T C 3: 64,275,618 H220R possibly damaging Het
Wdr5 A G 2: 27,533,374 Y260C probably damaging Het
Wisp3 T C 10: 39,151,355 T294A probably damaging Het
Other mutations in Plscr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Plscr4 APN 9 92484945 missense probably null 1.00
IGL02506:Plscr4 APN 9 92489991 missense possibly damaging 0.67
R0331:Plscr4 UTSW 9 92482642 missense probably damaging 1.00
R0360:Plscr4 UTSW 9 92488761 splice site probably benign
R0838:Plscr4 UTSW 9 92471760 splice site probably benign
R0898:Plscr4 UTSW 9 92484753 missense probably damaging 0.98
R1845:Plscr4 UTSW 9 92490046 missense probably damaging 1.00
R1895:Plscr4 UTSW 9 92483836 missense probably damaging 0.99
R1946:Plscr4 UTSW 9 92483836 missense probably damaging 0.99
R2127:Plscr4 UTSW 9 92488630 missense possibly damaging 0.82
R3427:Plscr4 UTSW 9 92488744 missense probably damaging 0.99
R4670:Plscr4 UTSW 9 92482867 critical splice donor site probably null
R4764:Plscr4 UTSW 9 92484780 missense probably damaging 0.99
R4958:Plscr4 UTSW 9 92484761 missense possibly damaging 0.95
R5126:Plscr4 UTSW 9 92488741 missense probably damaging 1.00
R5424:Plscr4 UTSW 9 92490022 missense possibly damaging 0.67
R6250:Plscr4 UTSW 9 92484828 missense possibly damaging 0.79
R6476:Plscr4 UTSW 9 92490766 missense probably benign 0.01
R6810:Plscr4 UTSW 9 92483836 missense probably damaging 0.99
R6982:Plscr4 UTSW 9 92482743 missense probably benign 0.00
R7127:Plscr4 UTSW 9 92490778 nonsense probably null
R7190:Plscr4 UTSW 9 92488641 missense probably benign 0.11
R7741:Plscr4 UTSW 9 92482640 critical splice acceptor site probably null
R7818:Plscr4 UTSW 9 92490790 nonsense probably null
R7819:Plscr4 UTSW 9 92490790 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTCATCTGCTTGAGAACACAGGC -3'
(R):5'- ATGCACTGTCTACCTGCAAATC -3'

Sequencing Primer
(F):5'- TTGAGAACACAGGCCCTGCTG -3'
(R):5'- TGTCTACCTGCAAATCCACCATCG -3'
Posted On2018-08-29