Incidental Mutation 'R6786:Dnah14'
ID 532345
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Name dynein, axonemal, heavy chain 14
Synonyms A230079K17Rik, Dnahc14, Gm980, LOC381311
MMRRC Submission 044900-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R6786 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 181404158-181642306 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 181468970 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1267 (I1267F)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208001]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000208001
AA Change: I1267F

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a C A 4: 56,744,116 (GRCm39) Y214* probably null Het
Adnp2 A G 18: 80,172,960 (GRCm39) V483A probably benign Het
Aif1 C T 17: 35,390,472 (GRCm39) V93M probably damaging Het
Alpk2 A G 18: 65,439,705 (GRCm39) S563P probably benign Het
Ank2 A T 3: 126,752,581 (GRCm39) N378K probably damaging Het
Ano4 C T 10: 88,828,732 (GRCm39) probably null Het
Asxl3 G A 18: 22,658,497 (GRCm39) C2169Y probably damaging Het
Atp2b1 T C 10: 98,852,821 (GRCm39) C101R probably damaging Het
Bcs1l C T 1: 74,629,844 (GRCm39) R224C probably damaging Het
Car2 T C 3: 14,951,710 (GRCm39) probably benign Het
Cbln1 T C 8: 88,198,657 (GRCm39) N71S probably benign Het
Cdh8 T A 8: 99,950,579 (GRCm39) T224S probably benign Het
Cdin1 A G 2: 115,462,462 (GRCm39) I65V probably benign Het
Cep131 G A 11: 119,956,218 (GRCm39) R1014W probably damaging Het
Cfap61 T C 2: 145,887,363 (GRCm39) S603P possibly damaging Het
Chd8 G T 14: 52,464,125 (GRCm39) L659I probably benign Het
Ckap5 G A 2: 91,387,920 (GRCm39) G255D probably benign Het
Clec18a C A 8: 111,807,572 (GRCm39) W126L probably benign Het
Cux1 T A 5: 136,596,085 (GRCm39) N4Y probably damaging Het
Dgcr8 A T 16: 18,101,693 (GRCm39) Y196* probably null Het
Dock7 T C 4: 98,949,529 (GRCm39) N438D probably benign Het
Dock8 A T 19: 25,160,386 (GRCm39) H1763L possibly damaging Het
Elp1 T C 4: 56,771,555 (GRCm39) D914G possibly damaging Het
Fpr-rs6 A T 17: 20,403,100 (GRCm39) M87K possibly damaging Het
Gabrg1 A G 5: 70,911,610 (GRCm39) S339P probably benign Het
Gm10801 AAGT AAGTAGT 2: 98,494,148 (GRCm39) probably null Het
Gm12695 A G 4: 96,651,058 (GRCm39) S132P probably damaging Het
Gm3443 T A 19: 21,533,128 (GRCm39) C31S probably damaging Het
Gzmf A T 14: 56,444,452 (GRCm39) F40L probably benign Het
Herc1 TCCC TCC 9: 66,408,470 (GRCm39) probably null Het
Lrguk A G 6: 34,072,522 (GRCm39) E604G probably benign Het
Marveld3 C A 8: 110,674,732 (GRCm39) K361N probably benign Het
Mgat4b A T 11: 50,121,525 (GRCm39) Y47F probably damaging Het
Mmel1 G T 4: 154,976,885 (GRCm39) E520* probably null Het
Msantd5f6 A T 4: 73,321,843 (GRCm39) M64K possibly damaging Het
Muc21 T C 17: 35,934,057 (GRCm39) probably benign Het
Myod1 A G 7: 46,027,741 (GRCm39) T294A probably benign Het
Nfix A T 8: 85,454,276 (GRCm39) S219T probably damaging Het
Nr4a2 A G 2: 57,001,920 (GRCm39) F115L probably benign Het
Numa1 A C 7: 101,641,845 (GRCm39) M98L probably benign Het
Or5b105 T C 19: 13,080,567 (GRCm39) I28V probably benign Het
P3h1 C T 4: 119,095,151 (GRCm39) L303F possibly damaging Het
Pias4 G A 10: 80,993,080 (GRCm39) T5I probably damaging Het
Pik3ip1 A G 11: 3,282,124 (GRCm39) N68S probably benign Het
Pkdrej T C 15: 85,702,850 (GRCm39) T1029A probably benign Het
Recql A T 6: 142,310,278 (GRCm39) D517E probably benign Het
Sall2 G T 14: 52,552,078 (GRCm39) H372Q probably damaging Het
Scn8a A C 15: 100,930,096 (GRCm39) I1436L probably benign Het
Slc4a5 T C 6: 83,273,729 (GRCm39) probably null Het
Stox2 A C 8: 47,639,500 (GRCm39) F898C probably damaging Het
Sumo2 A T 11: 115,414,601 (GRCm39) probably null Het
Sycp2 C T 2: 178,025,345 (GRCm39) E366K possibly damaging Het
Tanc1 A G 2: 59,622,150 (GRCm39) K423R probably benign Het
Tbx21 T A 11: 97,005,872 (GRCm39) Q31L possibly damaging Het
Tfap2a T A 13: 40,882,230 (GRCm39) N25I probably damaging Het
Tfdp1 C T 8: 13,420,485 (GRCm39) R105W probably damaging Het
Trav18 G A 14: 54,069,122 (GRCm39) V55I probably benign Het
Trgc1 A T 13: 19,400,646 (GRCm39) D125V unknown Het
Trim55 A G 3: 19,726,938 (GRCm39) D335G probably benign Het
Trim71 T A 9: 114,341,772 (GRCm39) T837S probably benign Het
Vmn1r56 T C 7: 5,198,961 (GRCm39) T219A probably benign Het
Vmn2r17 A T 5: 109,575,695 (GRCm39) T189S probably benign Het
Xaf1 A G 11: 72,197,461 (GRCm39) T146A probably benign Het
Zdbf2 T C 1: 63,343,679 (GRCm39) V686A possibly damaging Het
Zfp65 T C 13: 67,856,130 (GRCm39) H383R probably damaging Het
Zfp932 A G 5: 110,157,606 (GRCm39) T435A probably damaging Het
Zfp947 C T 17: 22,364,750 (GRCm39) G308D probably benign Het
Zswim3 T A 2: 164,662,771 (GRCm39) V417E probably damaging Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181,579,611 (GRCm39) missense probably benign 0.17
IGL01764:Dnah14 APN 1 181,572,342 (GRCm39) missense probably benign 0.00
IGL03218:Dnah14 APN 1 181,582,834 (GRCm39) missense probably benign 0.02
IGL03290:Dnah14 APN 1 181,591,543 (GRCm39) splice site probably benign
IGL03384:Dnah14 APN 1 181,573,514 (GRCm39) missense probably benign 0.03
R0009:Dnah14 UTSW 1 181,596,972 (GRCm39) splice site probably benign
R0125:Dnah14 UTSW 1 181,579,628 (GRCm39) missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181,572,312 (GRCm39) missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181,577,742 (GRCm39) missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181,591,525 (GRCm39) missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181,580,127 (GRCm39) missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181,582,806 (GRCm39) critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181,584,788 (GRCm39) missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181,584,799 (GRCm39) missense probably benign 0.01
R5424:Dnah14 UTSW 1 181,590,875 (GRCm39) missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181,568,724 (GRCm39) missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181,597,670 (GRCm39) missense probably benign 0.00
R6052:Dnah14 UTSW 1 181,494,052 (GRCm39) missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181,536,616 (GRCm39) missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181,577,719 (GRCm39) missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181,449,398 (GRCm39) missense probably benign 0.13
R6145:Dnah14 UTSW 1 181,493,982 (GRCm39) missense probably benign 0.00
R6163:Dnah14 UTSW 1 181,493,926 (GRCm39) missense probably benign 0.33
R6246:Dnah14 UTSW 1 181,508,453 (GRCm39) missense probably benign 0.00
R6302:Dnah14 UTSW 1 181,428,771 (GRCm39) missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181,412,589 (GRCm39) frame shift probably null
R6326:Dnah14 UTSW 1 181,611,121 (GRCm39) missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181,454,285 (GRCm39) missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181,582,951 (GRCm39) splice site probably null
R6376:Dnah14 UTSW 1 181,433,459 (GRCm39) missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181,478,767 (GRCm39) critical splice donor site probably null
R6433:Dnah14 UTSW 1 181,479,222 (GRCm39) missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181,611,270 (GRCm39) missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181,572,333 (GRCm39) missense probably benign 0.26
R6523:Dnah14 UTSW 1 181,471,186 (GRCm39) missense probably benign 0.00
R6529:Dnah14 UTSW 1 181,494,034 (GRCm39) missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181,412,550 (GRCm39) missense unknown
R6546:Dnah14 UTSW 1 181,566,552 (GRCm39) missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181,421,017 (GRCm39) missense probably benign 0.07
R6762:Dnah14 UTSW 1 181,584,824 (GRCm39) missense probably damaging 1.00
R6849:Dnah14 UTSW 1 181,636,510 (GRCm39) missense probably benign 0.00
R6877:Dnah14 UTSW 1 181,455,997 (GRCm39) missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181,577,748 (GRCm39) missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181,412,631 (GRCm39) missense probably benign 0.04
R6924:Dnah14 UTSW 1 181,455,517 (GRCm39) missense probably benign 0.04
R6957:Dnah14 UTSW 1 181,612,740 (GRCm39) missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181,475,795 (GRCm39) missense probably benign 0.00
R7018:Dnah14 UTSW 1 181,454,509 (GRCm39) missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181,450,568 (GRCm39) missense probably benign 0.01
R7058:Dnah14 UTSW 1 181,525,614 (GRCm39) missense probably benign 0.00
R7068:Dnah14 UTSW 1 181,597,355 (GRCm39) missense probably benign 0.35
R7115:Dnah14 UTSW 1 181,547,710 (GRCm39) missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181,573,523 (GRCm39) nonsense probably null
R7165:Dnah14 UTSW 1 181,532,100 (GRCm39) missense probably benign 0.00
R7169:Dnah14 UTSW 1 181,529,930 (GRCm39) missense probably benign 0.00
R7184:Dnah14 UTSW 1 181,532,094 (GRCm39) nonsense probably null
R7232:Dnah14 UTSW 1 181,584,928 (GRCm39) missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181,534,309 (GRCm39) missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181,513,372 (GRCm39) missense probably benign 0.41
R7290:Dnah14 UTSW 1 181,455,739 (GRCm39) missense probably benign 0.20
R7314:Dnah14 UTSW 1 181,612,819 (GRCm39) splice site probably null
R7326:Dnah14 UTSW 1 181,425,968 (GRCm39) missense probably benign 0.02
R7336:Dnah14 UTSW 1 181,625,299 (GRCm39) missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181,518,089 (GRCm39) splice site probably null
R7371:Dnah14 UTSW 1 181,454,450 (GRCm39) missense probably benign 0.05
R7376:Dnah14 UTSW 1 181,590,967 (GRCm39) missense probably benign 0.03
R7418:Dnah14 UTSW 1 181,444,307 (GRCm39) missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181,579,704 (GRCm39) missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181,455,632 (GRCm39) missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181,597,619 (GRCm39) missense probably benign 0.26
R7641:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7663:Dnah14 UTSW 1 181,579,720 (GRCm39) splice site probably null
R7674:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7680:Dnah14 UTSW 1 181,513,365 (GRCm39) missense probably benign 0.15
R7709:Dnah14 UTSW 1 181,530,049 (GRCm39) critical splice donor site probably null
R7842:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181,444,324 (GRCm39) missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181,611,139 (GRCm39) missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181,475,876 (GRCm39) missense probably benign 0.05
R8042:Dnah14 UTSW 1 181,471,196 (GRCm39) critical splice donor site probably null
R8071:Dnah14 UTSW 1 181,443,459 (GRCm39) missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181,593,797 (GRCm39) missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181,633,597 (GRCm39) nonsense probably null
R8139:Dnah14 UTSW 1 181,582,853 (GRCm39) missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181,484,598 (GRCm39) missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181,515,770 (GRCm39) missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181,517,666 (GRCm39) missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181,492,430 (GRCm39) missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181,572,357 (GRCm39) missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181,601,376 (GRCm39) missense probably benign 0.03
R8289:Dnah14 UTSW 1 181,543,780 (GRCm39) nonsense probably null
R8323:Dnah14 UTSW 1 181,532,109 (GRCm39) missense probably benign 0.01
R8442:Dnah14 UTSW 1 181,568,849 (GRCm39) missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181,633,577 (GRCm39) missense
R8507:Dnah14 UTSW 1 181,468,979 (GRCm39) missense probably benign 0.02
R8509:Dnah14 UTSW 1 181,642,220 (GRCm39) missense
R8520:Dnah14 UTSW 1 181,481,203 (GRCm39) missense probably damaging 1.00
R8530:Dnah14 UTSW 1 181,492,511 (GRCm39) missense probably damaging 1.00
R8703:Dnah14 UTSW 1 181,493,576 (GRCm39) nonsense probably null
R8710:Dnah14 UTSW 1 181,517,876 (GRCm39) missense probably benign 0.04
R8752:Dnah14 UTSW 1 181,455,581 (GRCm39) missense probably benign 0.00
R8792:Dnah14 UTSW 1 181,642,189 (GRCm39) missense
R8797:Dnah14 UTSW 1 181,465,412 (GRCm39) missense probably benign 0.19
R8821:Dnah14 UTSW 1 181,619,569 (GRCm39) nonsense probably null
R8834:Dnah14 UTSW 1 181,444,315 (GRCm39) missense possibly damaging 0.83
R8913:Dnah14 UTSW 1 181,553,063 (GRCm39) missense probably benign 0.01
R8925:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8927:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8934:Dnah14 UTSW 1 181,450,288 (GRCm39) missense possibly damaging 0.84
R9090:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9169:Dnah14 UTSW 1 181,433,381 (GRCm39) missense probably benign 0.06
R9199:Dnah14 UTSW 1 181,478,566 (GRCm39) missense possibly damaging 0.50
R9212:Dnah14 UTSW 1 181,628,852 (GRCm39) missense possibly damaging 0.95
R9213:Dnah14 UTSW 1 181,444,205 (GRCm39) critical splice donor site probably null
R9271:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9282:Dnah14 UTSW 1 181,642,077 (GRCm39) missense
R9350:Dnah14 UTSW 1 181,562,369 (GRCm39) missense possibly damaging 0.79
R9358:Dnah14 UTSW 1 181,536,598 (GRCm39) missense probably benign 0.01
R9436:Dnah14 UTSW 1 181,508,348 (GRCm39) missense probably damaging 1.00
R9484:Dnah14 UTSW 1 181,625,311 (GRCm39) missense probably benign 0.01
R9484:Dnah14 UTSW 1 181,517,773 (GRCm39) missense probably benign 0.45
R9486:Dnah14 UTSW 1 181,508,494 (GRCm39) missense possibly damaging 0.68
R9546:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9547:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9578:Dnah14 UTSW 1 181,502,007 (GRCm39) missense probably benign 0.16
R9654:Dnah14 UTSW 1 181,593,904 (GRCm39) missense probably benign 0.01
R9681:Dnah14 UTSW 1 181,562,414 (GRCm39) missense possibly damaging 0.91
R9683:Dnah14 UTSW 1 181,426,509 (GRCm39) missense probably benign 0.01
R9687:Dnah14 UTSW 1 181,425,978 (GRCm39) missense probably benign 0.01
R9718:Dnah14 UTSW 1 181,450,544 (GRCm39) missense probably benign 0.08
R9751:Dnah14 UTSW 1 181,619,610 (GRCm39) missense probably damaging 1.00
R9757:Dnah14 UTSW 1 181,513,349 (GRCm39) missense probably benign 0.03
RF007:Dnah14 UTSW 1 181,513,374 (GRCm39) missense probably benign 0.00
RF012:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181,584,916 (GRCm39) missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181,517,885 (GRCm39) missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181,593,869 (GRCm39) missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181,590,899 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCAGCAACGATGAACTTCTTG -3'
(R):5'- GATGGGAGAGGCTATGTTCAC -3'

Sequencing Primer
(F):5'- CAGCAACGATGAACTTCTTGATATTC -3'
(R):5'- GGCTATGTTCACAAAAGGATGTTATC -3'
Posted On 2018-08-29