Incidental Mutation 'R6786:Pik3ip1'
ID532386
Institutional Source Beutler Lab
Gene Symbol Pik3ip1
Ensembl Gene ENSMUSG00000034614
Gene Namephosphoinositide-3-kinase interacting protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R6786 (G1)
Quality Score218.009
Status Validated
Chromosome11
Chromosomal Location3330401-3342971 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3332124 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 68 (N68S)
Ref Sequence ENSEMBL: ENSMUSP00000122407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045153] [ENSMUST00000093399] [ENSMUST00000136474] [ENSMUST00000136536]
Predicted Effect probably benign
Transcript: ENSMUST00000045153
AA Change: N68S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000036921
Gene: ENSMUSG00000034614
AA Change: N68S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KR 23 103 3.64e-17 SMART
transmembrane domain 170 192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093399
AA Change: N68S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000091100
Gene: ENSMUSG00000034614
AA Change: N68S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KR 23 103 3.64e-17 SMART
transmembrane domain 169 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136474
SMART Domains Protein: ENSMUSP00000119106
Gene: ENSMUSG00000034614

DomainStartEndE-ValueType
transmembrane domain 69 91 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136536
AA Change: N68S

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122407
Gene: ENSMUSG00000034614
AA Change: N68S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KR 23 103 1.1e-16 SMART
transmembrane domain 177 199 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000138907
AA Change: N5S
SMART Domains Protein: ENSMUSP00000121277
Gene: ENSMUSG00000034614
AA Change: N5S

DomainStartEndE-ValueType
KR 1 41 7.93e-3 SMART
transmembrane domain 108 130 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 96% (66/69)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a C A 4: 56,744,116 Y214* probably null Het
Adnp2 A G 18: 80,129,745 V483A probably benign Het
Aif1 C T 17: 35,171,496 V93M probably damaging Het
Alpk2 A G 18: 65,306,634 S563P probably benign Het
Ank2 A T 3: 126,958,932 N378K probably damaging Het
Ano4 C T 10: 88,992,870 probably null Het
Asxl3 G A 18: 22,525,440 C2169Y probably damaging Het
Atp2b1 T C 10: 99,016,959 C101R probably damaging Het
BC052040 A G 2: 115,631,981 I65V probably benign Het
Bcs1l C T 1: 74,590,685 R224C probably damaging Het
Car2 T C 3: 14,886,650 probably benign Het
Cbln1 T C 8: 87,472,029 N71S probably benign Het
Cdh8 T A 8: 99,223,947 T224S probably benign Het
Cep131 G A 11: 120,065,392 R1014W probably damaging Het
Cfap61 T C 2: 146,045,443 S603P possibly damaging Het
Chd8 G T 14: 52,226,668 L659I probably benign Het
Ckap5 G A 2: 91,557,575 G255D probably benign Het
Clec18a C A 8: 111,080,940 W126L probably benign Het
Cux1 T A 5: 136,567,231 N4Y probably damaging Het
Dgcr8 A T 16: 18,283,829 Y196* probably null Het
Dnah14 A T 1: 181,641,405 I1267F probably benign Het
Dock7 T C 4: 99,061,292 N438D probably benign Het
Dock8 A T 19: 25,183,022 H1763L possibly damaging Het
Fpr-rs6 A T 17: 20,182,838 M87K possibly damaging Het
Gabrg1 A G 5: 70,754,267 S339P probably benign Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Gm11487 A T 4: 73,403,606 M64K possibly damaging Het
Gm12695 A G 4: 96,762,821 S132P probably damaging Het
Gm3443 T A 19: 21,555,764 C31S probably damaging Het
Gm9573 T C 17: 35,623,165 probably benign Het
Gzmf A T 14: 56,206,995 F40L probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Ikbkap T C 4: 56,771,555 D914G possibly damaging Het
Lrguk A G 6: 34,095,587 E604G probably benign Het
Marveld3 C A 8: 109,948,100 K361N probably benign Het
Mgat4b A T 11: 50,230,698 Y47F probably damaging Het
Mmel1 G T 4: 154,892,428 E520* probably null Het
Myod1 A G 7: 46,378,317 T294A probably benign Het
Nfix A T 8: 84,727,647 S219T probably damaging Het
Nr4a2 A G 2: 57,111,908 F115L probably benign Het
Numa1 A C 7: 101,992,638 M98L probably benign Het
Olfr1458 T C 19: 13,103,203 I28V probably benign Het
P3h1 C T 4: 119,237,954 L303F possibly damaging Het
Pias4 G A 10: 81,157,246 T5I probably damaging Het
Pkdrej T C 15: 85,818,649 T1029A probably benign Het
Recql A T 6: 142,364,552 D517E probably benign Het
Sall2 G T 14: 52,314,621 H372Q probably damaging Het
Scn8a A C 15: 101,032,215 I1436L probably benign Het
Slc4a5 T C 6: 83,296,747 probably null Het
Stox2 A C 8: 47,186,465 F898C probably damaging Het
Sumo2 A T 11: 115,523,775 probably null Het
Sycp2 C T 2: 178,383,552 E366K possibly damaging Het
Tanc1 A G 2: 59,791,806 K423R probably benign Het
Tbx21 T A 11: 97,115,046 Q31L possibly damaging Het
Tcrg-C1 A T 13: 19,216,476 D125V unknown Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tfdp1 C T 8: 13,370,485 R105W probably damaging Het
Trav18 G A 14: 53,831,665 V55I probably benign Het
Trim55 A G 3: 19,672,774 D335G probably benign Het
Trim71 T A 9: 114,512,704 T837S probably benign Het
Vmn1r56 T C 7: 5,195,962 T219A probably benign Het
Vmn2r17 A T 5: 109,427,829 T189S probably benign Het
Xaf1 A G 11: 72,306,635 T146A probably benign Het
Zdbf2 T C 1: 63,304,520 V686A possibly damaging Het
Zfp65 T C 13: 67,708,011 H383R probably damaging Het
Zfp932 A G 5: 110,009,740 T435A probably damaging Het
Zfp947 C T 17: 22,145,769 G308D probably benign Het
Zswim3 T A 2: 164,820,851 V417E probably damaging Het
Other mutations in Pik3ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03030:Pik3ip1 APN 11 3333259 missense possibly damaging 0.92
R1892:Pik3ip1 UTSW 11 3333304 missense probably damaging 1.00
R3940:Pik3ip1 UTSW 11 3331987 missense probably damaging 0.97
R4610:Pik3ip1 UTSW 11 3333327 missense probably damaging 1.00
R4818:Pik3ip1 UTSW 11 3330928 unclassified probably benign
R5032:Pik3ip1 UTSW 11 3333520 missense probably damaging 0.99
R7538:Pik3ip1 UTSW 11 3333558 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAGGCTGCTTCTGGGACAAC -3'
(R):5'- CTGGAGATAGCTCTGGCCAATC -3'

Sequencing Primer
(F):5'- TTCTGGGACAACGGCCAC -3'
(R):5'- AGTACCTGGGCAACTCAC -3'
Posted On2018-08-29