Incidental Mutation 'R6786:Xaf1'
ID532388
Institutional Source Beutler Lab
Gene Symbol Xaf1
Ensembl Gene ENSMUSG00000040483
Gene NameXIAP associated factor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6786 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location72301629-72313733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72306635 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 146 (T146A)
Ref Sequence ENSEMBL: ENSMUSP00000123011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094041] [ENSMUST00000140842] [ENSMUST00000146233] [ENSMUST00000151440]
Predicted Effect probably benign
Transcript: ENSMUST00000094041
Predicted Effect probably benign
Transcript: ENSMUST00000140842
SMART Domains Protein: ENSMUSP00000121472
Gene: ENSMUSG00000040483

DomainStartEndE-ValueType
PDB:2LXW|A 133 175 7e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000146233
AA Change: T146A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000123011
Gene: ENSMUSG00000040483
AA Change: T146A

DomainStartEndE-ValueType
PDB:2LXW|A 228 270 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000151440
SMART Domains Protein: ENSMUSP00000121483
Gene: ENSMUSG00000040483

DomainStartEndE-ValueType
PDB:2LXW|A 133 165 7e-9 PDB
low complexity region 194 205 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which binds to and counteracts the inhibitory effect of a member of the IAP (inhibitor of apoptosis) protein family. IAP proteins bind to and inhibit caspases which are activated during apoptosis. The proportion of IAPs and proteins which interfere with their activity, such as the encoded protein, affect the progress of the apoptosis signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a C A 4: 56,744,116 Y214* probably null Het
Adnp2 A G 18: 80,129,745 V483A probably benign Het
Aif1 C T 17: 35,171,496 V93M probably damaging Het
Alpk2 A G 18: 65,306,634 S563P probably benign Het
Ank2 A T 3: 126,958,932 N378K probably damaging Het
Ano4 C T 10: 88,992,870 probably null Het
Asxl3 G A 18: 22,525,440 C2169Y probably damaging Het
Atp2b1 T C 10: 99,016,959 C101R probably damaging Het
BC052040 A G 2: 115,631,981 I65V probably benign Het
Bcs1l C T 1: 74,590,685 R224C probably damaging Het
Car2 T C 3: 14,886,650 probably benign Het
Cbln1 T C 8: 87,472,029 N71S probably benign Het
Cdh8 T A 8: 99,223,947 T224S probably benign Het
Cep131 G A 11: 120,065,392 R1014W probably damaging Het
Cfap61 T C 2: 146,045,443 S603P possibly damaging Het
Chd8 G T 14: 52,226,668 L659I probably benign Het
Ckap5 G A 2: 91,557,575 G255D probably benign Het
Clec18a C A 8: 111,080,940 W126L probably benign Het
Cux1 T A 5: 136,567,231 N4Y probably damaging Het
Dgcr8 A T 16: 18,283,829 Y196* probably null Het
Dnah14 A T 1: 181,641,405 I1267F probably benign Het
Dock7 T C 4: 99,061,292 N438D probably benign Het
Dock8 A T 19: 25,183,022 H1763L possibly damaging Het
Fpr-rs6 A T 17: 20,182,838 M87K possibly damaging Het
Gabrg1 A G 5: 70,754,267 S339P probably benign Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Gm11487 A T 4: 73,403,606 M64K possibly damaging Het
Gm12695 A G 4: 96,762,821 S132P probably damaging Het
Gm3443 T A 19: 21,555,764 C31S probably damaging Het
Gm9573 T C 17: 35,623,165 probably benign Het
Gzmf A T 14: 56,206,995 F40L probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Ikbkap T C 4: 56,771,555 D914G possibly damaging Het
Lrguk A G 6: 34,095,587 E604G probably benign Het
Marveld3 C A 8: 109,948,100 K361N probably benign Het
Mgat4b A T 11: 50,230,698 Y47F probably damaging Het
Mmel1 G T 4: 154,892,428 E520* probably null Het
Myod1 A G 7: 46,378,317 T294A probably benign Het
Nfix A T 8: 84,727,647 S219T probably damaging Het
Nr4a2 A G 2: 57,111,908 F115L probably benign Het
Numa1 A C 7: 101,992,638 M98L probably benign Het
Olfr1458 T C 19: 13,103,203 I28V probably benign Het
P3h1 C T 4: 119,237,954 L303F possibly damaging Het
Pias4 G A 10: 81,157,246 T5I probably damaging Het
Pik3ip1 A G 11: 3,332,124 N68S probably benign Het
Pkdrej T C 15: 85,818,649 T1029A probably benign Het
Recql A T 6: 142,364,552 D517E probably benign Het
Sall2 G T 14: 52,314,621 H372Q probably damaging Het
Scn8a A C 15: 101,032,215 I1436L probably benign Het
Slc4a5 T C 6: 83,296,747 probably null Het
Stox2 A C 8: 47,186,465 F898C probably damaging Het
Sumo2 A T 11: 115,523,775 probably null Het
Sycp2 C T 2: 178,383,552 E366K possibly damaging Het
Tanc1 A G 2: 59,791,806 K423R probably benign Het
Tbx21 T A 11: 97,115,046 Q31L possibly damaging Het
Tcrg-C1 A T 13: 19,216,476 D125V unknown Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tfdp1 C T 8: 13,370,485 R105W probably damaging Het
Trav18 G A 14: 53,831,665 V55I probably benign Het
Trim55 A G 3: 19,672,774 D335G probably benign Het
Trim71 T A 9: 114,512,704 T837S probably benign Het
Vmn1r56 T C 7: 5,195,962 T219A probably benign Het
Vmn2r17 A T 5: 109,427,829 T189S probably benign Het
Zdbf2 T C 1: 63,304,520 V686A possibly damaging Het
Zfp65 T C 13: 67,708,011 H383R probably damaging Het
Zfp932 A G 5: 110,009,740 T435A probably damaging Het
Zfp947 C T 17: 22,145,769 G308D probably benign Het
Zswim3 T A 2: 164,820,851 V417E probably damaging Het
Other mutations in Xaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02457:Xaf1 APN 11 72303431 missense possibly damaging 0.80
R0230:Xaf1 UTSW 11 72306555 intron probably benign
R1955:Xaf1 UTSW 11 72306606 missense possibly damaging 0.81
R2206:Xaf1 UTSW 11 72303402 missense possibly damaging 0.85
R2207:Xaf1 UTSW 11 72303402 missense possibly damaging 0.85
R4864:Xaf1 UTSW 11 72306856 intron probably benign
R5973:Xaf1 UTSW 11 72303430 missense probably damaging 0.98
R6463:Xaf1 UTSW 11 72308638 missense probably benign 0.01
R7199:Xaf1 UTSW 11 72303375 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCTGGGAATGCTCATGAGTAC -3'
(R):5'- CAGAGCTGCTCTTTGATGGG -3'

Sequencing Primer
(F):5'- ATGCTCATGAGTACAGGCCG -3'
(R):5'- TCTGCCCAAAGGAAACCTTGG -3'
Posted On2018-08-29