Mutagenetix > Incidental Mutation

Incidental Mutation 'R6786:Sall2'

532395

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6786 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 52314621 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 372 (H372Q)

Ref Sequence

ENSEMBL: ENSMUSP00000056401 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

AlphaFold

Q9QX96

Predicted Effect

probably damaging
Transcript: ENSMUST00000058326
AA Change: H372Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: H372Q

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135523
AA Change: H370Q

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.1%

Validation Efficiency

96% (66/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl7a	C	A	4: 56,744,116	Y214*	probably null	Het
Adnp2	A	G	18: 80,129,745	V483A	probably benign	Het
Aif1	C	T	17: 35,171,496	V93M	probably damaging	Het
Alpk2	A	G	18: 65,306,634	S563P	probably benign	Het
Ank2	A	T	3: 126,958,932	N378K	probably damaging	Het
Ano4	C	T	10: 88,992,870		probably null	Het
Asxl3	G	A	18: 22,525,440	C2169Y	probably damaging	Het
Atp2b1	T	C	10: 99,016,959	C101R	probably damaging	Het
BC052040	A	G	2: 115,631,981	I65V	probably benign	Het
Bcs1l	C	T	1: 74,590,685	R224C	probably damaging	Het
Car2	T	C	3: 14,886,650		probably benign	Het
Cbln1	T	C	8: 87,472,029	N71S	probably benign	Het
Cdh8	T	A	8: 99,223,947	T224S	probably benign	Het
Cep131	G	A	11: 120,065,392	R1014W	probably damaging	Het
Cfap61	T	C	2: 146,045,443	S603P	possibly damaging	Het
Chd8	G	T	14: 52,226,668	L659I	probably benign	Het
Ckap5	G	A	2: 91,557,575	G255D	probably benign	Het
Clec18a	C	A	8: 111,080,940	W126L	probably benign	Het
Cux1	T	A	5: 136,567,231	N4Y	probably damaging	Het
Dgcr8	A	T	16: 18,283,829	Y196*	probably null	Het
Dnah14	A	T	1: 181,641,405	I1267F	probably benign	Het
Dock7	T	C	4: 99,061,292	N438D	probably benign	Het
Dock8	A	T	19: 25,183,022	H1763L	possibly damaging	Het
Fpr-rs6	A	T	17: 20,182,838	M87K	possibly damaging	Het
Gabrg1	A	G	5: 70,754,267	S339P	probably benign	Het
Gm10801	AAGT	AAGTAGT	2: 98,663,803		probably null	Het
Gm11487	A	T	4: 73,403,606	M64K	possibly damaging	Het
Gm12695	A	G	4: 96,762,821	S132P	probably damaging	Het
Gm3443	T	A	19: 21,555,764	C31S	probably damaging	Het
Gm9573	T	C	17: 35,623,165		probably benign	Het
Gzmf	A	T	14: 56,206,995	F40L	probably benign	Het
Herc1	TCCC	TCC	9: 66,501,188		probably null	Het
Ikbkap	T	C	4: 56,771,555	D914G	possibly damaging	Het
Lrguk	A	G	6: 34,095,587	E604G	probably benign	Het
Marveld3	C	A	8: 109,948,100	K361N	probably benign	Het
Mgat4b	A	T	11: 50,230,698	Y47F	probably damaging	Het
Mmel1	G	T	4: 154,892,428	E520*	probably null	Het
Myod1	A	G	7: 46,378,317	T294A	probably benign	Het
Nfix	A	T	8: 84,727,647	S219T	probably damaging	Het
Nr4a2	A	G	2: 57,111,908	F115L	probably benign	Het
Numa1	A	C	7: 101,992,638	M98L	probably benign	Het
Olfr1458	T	C	19: 13,103,203	I28V	probably benign	Het
P3h1	C	T	4: 119,237,954	L303F	possibly damaging	Het
Pias4	G	A	10: 81,157,246	T5I	probably damaging	Het
Pik3ip1	A	G	11: 3,332,124	N68S	probably benign	Het
Pkdrej	T	C	15: 85,818,649	T1029A	probably benign	Het
Recql	A	T	6: 142,364,552	D517E	probably benign	Het
Scn8a	A	C	15: 101,032,215	I1436L	probably benign	Het
Slc4a5	T	C	6: 83,296,747		probably null	Het
Stox2	A	C	8: 47,186,465	F898C	probably damaging	Het
Sumo2	A	T	11: 115,523,775		probably null	Het
Sycp2	C	T	2: 178,383,552	E366K	possibly damaging	Het
Tanc1	A	G	2: 59,791,806	K423R	probably benign	Het
Tbx21	T	A	11: 97,115,046	Q31L	possibly damaging	Het
Tcrg-C1	A	T	13: 19,216,476	D125V	unknown	Het
Tfap2a	T	A	13: 40,728,754	N25I	probably damaging	Het
Tfdp1	C	T	8: 13,370,485	R105W	probably damaging	Het
Trav18	G	A	14: 53,831,665	V55I	probably benign	Het
Trim55	A	G	3: 19,672,774	D335G	probably benign	Het
Trim71	T	A	9: 114,512,704	T837S	probably benign	Het
Vmn1r56	T	C	7: 5,195,962	T219A	probably benign	Het
Vmn2r17	A	T	5: 109,427,829	T189S	probably benign	Het
Xaf1	A	G	11: 72,306,635	T146A	probably benign	Het
Zdbf2	T	C	1: 63,304,520	V686A	possibly damaging	Het
Zfp65	T	C	13: 67,708,011	H383R	probably damaging	Het
Zfp932	A	G	5: 110,009,740	T435A	probably damaging	Het
Zfp947	C	T	17: 22,145,769	G308D	probably benign	Het
Zswim3	T	A	2: 164,820,851	V417E	probably damaging	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1079:Sall2	UTSW	14	52313203	missense	probably benign	0.13
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1674:Sall2	UTSW	14	52313836	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1989:Sall2	UTSW	14	52314439	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4272:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4273:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4503:Sall2	UTSW	14	52313459	missense	probably benign
R4592:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4693:Sall2	UTSW	14	52314478	missense	probably damaging	1.00
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5007:Sall2	UTSW	14	52314493	missense	probably damaging	1.00
R5015:Sall2	UTSW	14	52315655	missense	possibly damaging	0.92
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5419:Sall2	UTSW	14	52313129	missense	probably damaging	1.00
R5849:Sall2	UTSW	14	52314247	missense	probably benign	0.13
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6397:Sall2	UTSW	14	52315153	missense	probably damaging	1.00
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313593	missense	probably damaging	1.00
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7496:Sall2	UTSW	14	52315561	missense	possibly damaging	0.63
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R8324:Sall2	UTSW	14	52312886	missense	probably benign	0.30
R9017:Sall2	UTSW	14	52313262	missense	possibly damaging	0.51
R9149:Sall2	UTSW	14	52313216	missense	possibly damaging	0.95
R9362:Sall2	UTSW	14	52313144	nonsense	probably null
R9571:Sall2	UTSW	14	52314373	missense	probably damaging	1.00
R9574:Sall2	UTSW	14	52314160	missense	probably damaging	1.00
R9641:Sall2	UTSW	14	52313425	missense	probably damaging	1.00
R9648:Sall2	UTSW	14	52313767	missense	probably damaging	1.00
R9694:Sall2	UTSW	14	52314667	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- TAGTCTAGGTGCTCCGGTACTG -3'
(R):5'- GCAGTACGGATCAGCTGATTG -3'

Sequencing Primer
(F):5'- ACTGGATGTGGATTCATTTGCAC -3'
(R):5'- GCTGATTGCTTCACCTCATCTGG -3'

Posted On

2018-08-29