Incidental Mutation 'R6786:Pkdrej'
ID532398
Institutional Source Beutler Lab
Gene Symbol Pkdrej
Ensembl Gene ENSMUSG00000052496
Gene Namepolycystin (PKD) family receptor for egg jelly
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6786 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location85814670-85821734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85818649 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1029 (T1029A)
Ref Sequence ENSEMBL: ENSMUSP00000086352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064370]
Predicted Effect probably benign
Transcript: ENSMUST00000064370
AA Change: T1029A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086352
Gene: ENSMUSG00000052496
AA Change: T1029A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:REJ 130 598 6.2e-116 PFAM
coiled coil region 657 687 N/A INTRINSIC
low complexity region 942 947 N/A INTRINSIC
GPS 984 1050 1.37e-2 SMART
transmembrane domain 1067 1089 N/A INTRINSIC
LH2 1114 1230 3.35e-6 SMART
transmembrane domain 1274 1292 N/A INTRINSIC
transmembrane domain 1312 1334 N/A INTRINSIC
low complexity region 1407 1415 N/A INTRINSIC
transmembrane domain 1451 1473 N/A INTRINSIC
transmembrane domain 1483 1505 N/A INTRINSIC
low complexity region 1571 1579 N/A INTRINSIC
transmembrane domain 1581 1603 N/A INTRINSIC
Pfam:PKD_channel 1621 2051 5.2e-154 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a receptor for egg jelly (REJ) domain, a G-protein-coupled receptor proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may play a role in human reproduction. Alternative splice variants have been described but their biological natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null males are fertile in unrestricted mating trials but show lower reproductive success in sequential mating and artificial insemination trials. Although mutant sperm are able to capacitate in vitro, they acquire exocytotic competence at a slower rate than wild-type sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a C A 4: 56,744,116 Y214* probably null Het
Adnp2 A G 18: 80,129,745 V483A probably benign Het
Aif1 C T 17: 35,171,496 V93M probably damaging Het
Alpk2 A G 18: 65,306,634 S563P probably benign Het
Ank2 A T 3: 126,958,932 N378K probably damaging Het
Ano4 C T 10: 88,992,870 probably null Het
Asxl3 G A 18: 22,525,440 C2169Y probably damaging Het
Atp2b1 T C 10: 99,016,959 C101R probably damaging Het
BC052040 A G 2: 115,631,981 I65V probably benign Het
Bcs1l C T 1: 74,590,685 R224C probably damaging Het
Car2 T C 3: 14,886,650 probably benign Het
Cbln1 T C 8: 87,472,029 N71S probably benign Het
Cdh8 T A 8: 99,223,947 T224S probably benign Het
Cep131 G A 11: 120,065,392 R1014W probably damaging Het
Cfap61 T C 2: 146,045,443 S603P possibly damaging Het
Chd8 G T 14: 52,226,668 L659I probably benign Het
Ckap5 G A 2: 91,557,575 G255D probably benign Het
Clec18a C A 8: 111,080,940 W126L probably benign Het
Cux1 T A 5: 136,567,231 N4Y probably damaging Het
Dgcr8 A T 16: 18,283,829 Y196* probably null Het
Dnah14 A T 1: 181,641,405 I1267F probably benign Het
Dock7 T C 4: 99,061,292 N438D probably benign Het
Dock8 A T 19: 25,183,022 H1763L possibly damaging Het
Fpr-rs6 A T 17: 20,182,838 M87K possibly damaging Het
Gabrg1 A G 5: 70,754,267 S339P probably benign Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Gm11487 A T 4: 73,403,606 M64K possibly damaging Het
Gm12695 A G 4: 96,762,821 S132P probably damaging Het
Gm3443 T A 19: 21,555,764 C31S probably damaging Het
Gm9573 T C 17: 35,623,165 probably benign Het
Gzmf A T 14: 56,206,995 F40L probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Ikbkap T C 4: 56,771,555 D914G possibly damaging Het
Lrguk A G 6: 34,095,587 E604G probably benign Het
Marveld3 C A 8: 109,948,100 K361N probably benign Het
Mgat4b A T 11: 50,230,698 Y47F probably damaging Het
Mmel1 G T 4: 154,892,428 E520* probably null Het
Myod1 A G 7: 46,378,317 T294A probably benign Het
Nfix A T 8: 84,727,647 S219T probably damaging Het
Nr4a2 A G 2: 57,111,908 F115L probably benign Het
Numa1 A C 7: 101,992,638 M98L probably benign Het
Olfr1458 T C 19: 13,103,203 I28V probably benign Het
P3h1 C T 4: 119,237,954 L303F possibly damaging Het
Pias4 G A 10: 81,157,246 T5I probably damaging Het
Pik3ip1 A G 11: 3,332,124 N68S probably benign Het
Recql A T 6: 142,364,552 D517E probably benign Het
Sall2 G T 14: 52,314,621 H372Q probably damaging Het
Scn8a A C 15: 101,032,215 I1436L probably benign Het
Slc4a5 T C 6: 83,296,747 probably null Het
Stox2 A C 8: 47,186,465 F898C probably damaging Het
Sumo2 A T 11: 115,523,775 probably null Het
Sycp2 C T 2: 178,383,552 E366K possibly damaging Het
Tanc1 A G 2: 59,791,806 K423R probably benign Het
Tbx21 T A 11: 97,115,046 Q31L possibly damaging Het
Tcrg-C1 A T 13: 19,216,476 D125V unknown Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tfdp1 C T 8: 13,370,485 R105W probably damaging Het
Trav18 G A 14: 53,831,665 V55I probably benign Het
Trim55 A G 3: 19,672,774 D335G probably benign Het
Trim71 T A 9: 114,512,704 T837S probably benign Het
Vmn1r56 T C 7: 5,195,962 T219A probably benign Het
Vmn2r17 A T 5: 109,427,829 T189S probably benign Het
Xaf1 A G 11: 72,306,635 T146A probably benign Het
Zdbf2 T C 1: 63,304,520 V686A possibly damaging Het
Zfp65 T C 13: 67,708,011 H383R probably damaging Het
Zfp932 A G 5: 110,009,740 T435A probably damaging Het
Zfp947 C T 17: 22,145,769 G308D probably benign Het
Zswim3 T A 2: 164,820,851 V417E probably damaging Het
Other mutations in Pkdrej
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pkdrej APN 15 85817226 missense probably damaging 1.00
IGL00981:Pkdrej APN 15 85819656 missense probably damaging 1.00
IGL01066:Pkdrej APN 15 85816159 missense probably benign 0.22
IGL01461:Pkdrej APN 15 85820374 missense possibly damaging 0.77
IGL01514:Pkdrej APN 15 85818063 missense possibly damaging 0.82
IGL01606:Pkdrej APN 15 85817700 missense possibly damaging 0.67
IGL01836:Pkdrej APN 15 85820958 missense probably damaging 1.00
IGL02089:Pkdrej APN 15 85816288 missense possibly damaging 0.87
IGL02197:Pkdrej APN 15 85815793 missense possibly damaging 0.89
IGL02331:Pkdrej APN 15 85821327 missense probably damaging 1.00
IGL02559:Pkdrej APN 15 85817848 missense probably benign
IGL02708:Pkdrej APN 15 85820787 missense probably damaging 1.00
IGL02739:Pkdrej APN 15 85819694 missense probably benign 0.41
IGL02741:Pkdrej APN 15 85817430 missense probably benign 0.04
IGL02882:Pkdrej APN 15 85817296 missense probably damaging 1.00
IGL02968:Pkdrej APN 15 85816181 nonsense probably null
IGL03250:Pkdrej APN 15 85821355 missense possibly damaging 0.92
FR4548:Pkdrej UTSW 15 85819680 small insertion probably benign
FR4737:Pkdrej UTSW 15 85819680 small insertion probably benign
PIT1430001:Pkdrej UTSW 15 85821292 missense probably damaging 0.99
PIT4280001:Pkdrej UTSW 15 85819935 missense probably benign 0.01
R0004:Pkdrej UTSW 15 85818183 missense probably damaging 1.00
R0116:Pkdrej UTSW 15 85817545 nonsense probably null
R0117:Pkdrej UTSW 15 85816099 unclassified probably null
R0137:Pkdrej UTSW 15 85821567 missense possibly damaging 0.95
R0141:Pkdrej UTSW 15 85815630 missense probably damaging 0.99
R0325:Pkdrej UTSW 15 85819551 missense probably benign 0.08
R0714:Pkdrej UTSW 15 85815511 missense possibly damaging 0.85
R0749:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0750:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0755:Pkdrej UTSW 15 85816135 missense probably benign 0.00
R0938:Pkdrej UTSW 15 85818163 missense probably damaging 1.00
R1126:Pkdrej UTSW 15 85816314 missense probably damaging 0.99
R1204:Pkdrej UTSW 15 85818312 missense probably damaging 1.00
R1353:Pkdrej UTSW 15 85818918 missense probably damaging 1.00
R1471:Pkdrej UTSW 15 85817133 missense probably benign 0.37
R1510:Pkdrej UTSW 15 85816762 missense possibly damaging 0.61
R1573:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R1588:Pkdrej UTSW 15 85817241 missense probably benign 0.44
R1739:Pkdrej UTSW 15 85820427 missense probably benign 0.03
R1779:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1781:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1828:Pkdrej UTSW 15 85819282 missense possibly damaging 0.48
R1865:Pkdrej UTSW 15 85820324 nonsense probably null
R1870:Pkdrej UTSW 15 85816431 missense probably damaging 1.00
R1937:Pkdrej UTSW 15 85819167 missense probably benign 0.00
R2069:Pkdrej UTSW 15 85821231 missense probably benign 0.01
R2113:Pkdrej UTSW 15 85818984 missense probably damaging 1.00
R2135:Pkdrej UTSW 15 85816506 missense probably damaging 1.00
R2428:Pkdrej UTSW 15 85817572 nonsense probably null
R2991:Pkdrej UTSW 15 85819936 missense probably benign 0.00
R3029:Pkdrej UTSW 15 85817004 missense probably benign 0.16
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3747:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3748:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3749:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R4028:Pkdrej UTSW 15 85817492 missense probably benign 0.02
R4169:Pkdrej UTSW 15 85816314 missense probably benign 0.24
R4241:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4242:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4705:Pkdrej UTSW 15 85821167 nonsense probably null
R4939:Pkdrej UTSW 15 85820283 missense possibly damaging 0.82
R4954:Pkdrej UTSW 15 85816401 missense probably damaging 0.99
R4974:Pkdrej UTSW 15 85820409 missense probably benign 0.00
R4982:Pkdrej UTSW 15 85818996 missense probably damaging 0.99
R5105:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R5270:Pkdrej UTSW 15 85818327 missense probably damaging 1.00
R5296:Pkdrej UTSW 15 85817118 missense possibly damaging 0.67
R5631:Pkdrej UTSW 15 85820437 missense probably benign
R5909:Pkdrej UTSW 15 85818296 missense possibly damaging 0.82
R5998:Pkdrej UTSW 15 85815453 missense probably benign 0.01
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6125:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R6270:Pkdrej UTSW 15 85821105 nonsense probably null
R6500:Pkdrej UTSW 15 85819546 missense probably damaging 0.98
R6776:Pkdrej UTSW 15 85817309 nonsense probably null
R6866:Pkdrej UTSW 15 85820881 missense probably damaging 1.00
R6954:Pkdrej UTSW 15 85817853 nonsense probably null
R7086:Pkdrej UTSW 15 85820116 missense probably damaging 1.00
R7231:Pkdrej UTSW 15 85816188 missense possibly damaging 0.55
R7233:Pkdrej UTSW 15 85821148 missense probably damaging 0.96
R7289:Pkdrej UTSW 15 85821100 missense probably benign
R7549:Pkdrej UTSW 15 85819793 missense probably damaging 1.00
R7582:Pkdrej UTSW 15 85818921 missense possibly damaging 0.92
R7677:Pkdrej UTSW 15 85815587 missense probably benign 0.01
R7791:Pkdrej UTSW 15 85815931 missense possibly damaging 0.87
R7873:Pkdrej UTSW 15 85816523 missense probably benign 0.29
R7956:Pkdrej UTSW 15 85816523 missense probably benign 0.29
Z1177:Pkdrej UTSW 15 85816537 missense not run
Predicted Primers PCR Primer
(F):5'- AGTCAGTATTACCACATTGTCCC -3'
(R):5'- GAAGCCCACTAACAAGCTAGTG -3'

Sequencing Primer
(F):5'- ACATCCCTGTGCAAGGC -3'
(R):5'- CTAACAAGCTAGTGAGAATTGCTC -3'
Posted On2018-08-29