Incidental Mutation 'R6786:Gm9573'
ID532404
Institutional Source Beutler Lab
Gene Symbol Gm9573
Ensembl Gene ENSMUSG00000090588
Gene Namepredicted gene 9573
SynonymsMuc21, epiglycanin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6786 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location35617923-35626637 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 35623165 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164502] [ENSMUST00000174521]
Predicted Effect unknown
Transcript: ENSMUST00000164502
AA Change: D43G
SMART Domains Protein: ENSMUSP00000130987
Gene: ENSMUSG00000090588
AA Change: D43G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 39 N/A INTRINSIC
low complexity region 42 59 N/A INTRINSIC
low complexity region 76 144 N/A INTRINSIC
low complexity region 149 578 N/A INTRINSIC
low complexity region 580 653 N/A INTRINSIC
low complexity region 655 1179 N/A INTRINSIC
low complexity region 1183 1373 N/A INTRINSIC
low complexity region 1383 1436 N/A INTRINSIC
low complexity region 1438 1479 N/A INTRINSIC
Pfam:Epiglycanin_C 1518 1605 3.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174521
SMART Domains Protein: ENSMUSP00000134221
Gene: ENSMUSG00000090509

DomainStartEndE-ValueType
Pfam:SFTA2 80 117 9.2e-18 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 96% (66/69)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a C A 4: 56,744,116 Y214* probably null Het
Adnp2 A G 18: 80,129,745 V483A probably benign Het
Aif1 C T 17: 35,171,496 V93M probably damaging Het
Alpk2 A G 18: 65,306,634 S563P probably benign Het
Ank2 A T 3: 126,958,932 N378K probably damaging Het
Ano4 C T 10: 88,992,870 probably null Het
Asxl3 G A 18: 22,525,440 C2169Y probably damaging Het
Atp2b1 T C 10: 99,016,959 C101R probably damaging Het
BC052040 A G 2: 115,631,981 I65V probably benign Het
Bcs1l C T 1: 74,590,685 R224C probably damaging Het
Car2 T C 3: 14,886,650 probably benign Het
Cbln1 T C 8: 87,472,029 N71S probably benign Het
Cdh8 T A 8: 99,223,947 T224S probably benign Het
Cep131 G A 11: 120,065,392 R1014W probably damaging Het
Cfap61 T C 2: 146,045,443 S603P possibly damaging Het
Chd8 G T 14: 52,226,668 L659I probably benign Het
Ckap5 G A 2: 91,557,575 G255D probably benign Het
Clec18a C A 8: 111,080,940 W126L probably benign Het
Cux1 T A 5: 136,567,231 N4Y probably damaging Het
Dgcr8 A T 16: 18,283,829 Y196* probably null Het
Dnah14 A T 1: 181,641,405 I1267F probably benign Het
Dock7 T C 4: 99,061,292 N438D probably benign Het
Dock8 A T 19: 25,183,022 H1763L possibly damaging Het
Fpr-rs6 A T 17: 20,182,838 M87K possibly damaging Het
Gabrg1 A G 5: 70,754,267 S339P probably benign Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Gm11487 A T 4: 73,403,606 M64K possibly damaging Het
Gm12695 A G 4: 96,762,821 S132P probably damaging Het
Gm3443 T A 19: 21,555,764 C31S probably damaging Het
Gzmf A T 14: 56,206,995 F40L probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Ikbkap T C 4: 56,771,555 D914G possibly damaging Het
Lrguk A G 6: 34,095,587 E604G probably benign Het
Marveld3 C A 8: 109,948,100 K361N probably benign Het
Mgat4b A T 11: 50,230,698 Y47F probably damaging Het
Mmel1 G T 4: 154,892,428 E520* probably null Het
Myod1 A G 7: 46,378,317 T294A probably benign Het
Nfix A T 8: 84,727,647 S219T probably damaging Het
Nr4a2 A G 2: 57,111,908 F115L probably benign Het
Numa1 A C 7: 101,992,638 M98L probably benign Het
Olfr1458 T C 19: 13,103,203 I28V probably benign Het
P3h1 C T 4: 119,237,954 L303F possibly damaging Het
Pias4 G A 10: 81,157,246 T5I probably damaging Het
Pik3ip1 A G 11: 3,332,124 N68S probably benign Het
Pkdrej T C 15: 85,818,649 T1029A probably benign Het
Recql A T 6: 142,364,552 D517E probably benign Het
Sall2 G T 14: 52,314,621 H372Q probably damaging Het
Scn8a A C 15: 101,032,215 I1436L probably benign Het
Slc4a5 T C 6: 83,296,747 probably null Het
Stox2 A C 8: 47,186,465 F898C probably damaging Het
Sumo2 A T 11: 115,523,775 probably null Het
Sycp2 C T 2: 178,383,552 E366K possibly damaging Het
Tanc1 A G 2: 59,791,806 K423R probably benign Het
Tbx21 T A 11: 97,115,046 Q31L possibly damaging Het
Tcrg-C1 A T 13: 19,216,476 D125V unknown Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tfdp1 C T 8: 13,370,485 R105W probably damaging Het
Trav18 G A 14: 53,831,665 V55I probably benign Het
Trim55 A G 3: 19,672,774 D335G probably benign Het
Trim71 T A 9: 114,512,704 T837S probably benign Het
Vmn1r56 T C 7: 5,195,962 T219A probably benign Het
Vmn2r17 A T 5: 109,427,829 T189S probably benign Het
Xaf1 A G 11: 72,306,635 T146A probably benign Het
Zdbf2 T C 1: 63,304,520 V686A possibly damaging Het
Zfp65 T C 13: 67,708,011 H383R probably damaging Het
Zfp932 A G 5: 110,009,740 T435A probably damaging Het
Zfp947 C T 17: 22,145,769 G308D probably benign Het
Zswim3 T A 2: 164,820,851 V417E probably damaging Het
Other mutations in Gm9573
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Gm9573 UTSW 17 35622121 intron probably benign
R0334:Gm9573 UTSW 17 35622722 intron probably benign
R0946:Gm9573 UTSW 17 35618213 missense probably benign 0.32
R1117:Gm9573 UTSW 17 35620028 intron probably benign
R1345:Gm9573 UTSW 17 35621597 intron probably benign
R1697:Gm9573 UTSW 17 35620648 intron probably benign
R1750:Gm9573 UTSW 17 35621048 intron probably benign
R1756:Gm9573 UTSW 17 35619239 intron probably benign
R1946:Gm9573 UTSW 17 35622524 intron probably benign
R1978:Gm9573 UTSW 17 35622965 intron probably benign
R1991:Gm9573 UTSW 17 35618708 missense probably benign 0.32
R1992:Gm9573 UTSW 17 35618708 missense probably benign 0.32
R2063:Gm9573 UTSW 17 35621405 intron probably benign
R2356:Gm9573 UTSW 17 35621671 intron probably benign
R2866:Gm9573 UTSW 17 35619707 intron probably benign
R3826:Gm9573 UTSW 17 35621612 intron probably benign
R4020:Gm9573 UTSW 17 35620061 intron probably benign
R4474:Gm9573 UTSW 17 35620604 intron probably benign
R4677:Gm9573 UTSW 17 35619707 intron probably benign
R4786:Gm9573 UTSW 17 35619329 intron probably benign
R5071:Gm9573 UTSW 17 35620552 intron probably benign
R5173:Gm9573 UTSW 17 35620741 intron probably benign
R5283:Gm9573 UTSW 17 35621332 intron probably benign
R5446:Gm9573 UTSW 17 35622503 intron probably benign
R5542:Gm9573 UTSW 17 35622503 intron probably benign
R5716:Gm9573 UTSW 17 35620783 intron probably benign
R5913:Gm9573 UTSW 17 35623231 intron probably benign
R6011:Gm9573 UTSW 17 35622182 intron probably benign
R6198:Gm9573 UTSW 17 35620916 intron probably benign
R6394:Gm9573 UTSW 17 35620166 intron probably benign
R6940:Gm9573 UTSW 17 35623226 intron probably benign
R7082:Gm9573 UTSW 17 35621201 missense unknown
R7103:Gm9573 UTSW 17 35621540 missense unknown
R7110:Gm9573 UTSW 17 35622618 intron probably benign
R7139:Gm9573 UTSW 17 35622633 intron probably benign
R7165:Gm9573 UTSW 17 35621978 missense unknown
R7200:Gm9573 UTSW 17 35622633 intron probably benign
R7204:Gm9573 UTSW 17 35621213 intron probably benign
R7289:Gm9573 UTSW 17 35618869 missense unknown
R7290:Gm9573 UTSW 17 35618869 missense unknown
R7295:Gm9573 UTSW 17 35618869 missense unknown
R7319:Gm9573 UTSW 17 35622043 intron probably benign
R7462:Gm9573 UTSW 17 35620676 missense unknown
R7529:Gm9573 UTSW 17 35619231 missense unknown
R7718:Gm9573 UTSW 17 35622836 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTAGATCCTGAGGCAGTGC -3'
(R):5'- ATCAAGAGTGGTGTGCACGG -3'

Sequencing Primer
(F):5'- ATCCTGAGGCAGTGCTGGATG -3'
(R):5'- CGGAGCACTGAGGAGCACTG -3'
Posted On2018-08-29