Incidental Mutation 'R6786:Olfr1458'
ID532408
Institutional Source Beutler Lab
Gene Symbol Olfr1458
Ensembl Gene ENSMUSG00000062844
Gene Nameolfactory receptor 1458
SynonymsEG667271, MOR202-24, GA_x6K02T2RE5P-3430689-3429787
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6786 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location13101593-13106775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13103203 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 28 (I28V)
Ref Sequence ENSEMBL: ENSMUSP00000076019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076729] [ENSMUST00000215160]
Predicted Effect probably benign
Transcript: ENSMUST00000076729
AA Change: I28V

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000076019
Gene: ENSMUSG00000062844
AA Change: I28V

DomainStartEndE-ValueType
Pfam:7tm_4 23 300 7.9e-51 PFAM
Pfam:7TM_GPCR_Srsx 27 297 1.2e-6 PFAM
Pfam:7tm_1 33 282 5.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215160
AA Change: I34V

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a C A 4: 56,744,116 Y214* probably null Het
Adnp2 A G 18: 80,129,745 V483A probably benign Het
Aif1 C T 17: 35,171,496 V93M probably damaging Het
Alpk2 A G 18: 65,306,634 S563P probably benign Het
Ank2 A T 3: 126,958,932 N378K probably damaging Het
Ano4 C T 10: 88,992,870 probably null Het
Asxl3 G A 18: 22,525,440 C2169Y probably damaging Het
Atp2b1 T C 10: 99,016,959 C101R probably damaging Het
BC052040 A G 2: 115,631,981 I65V probably benign Het
Bcs1l C T 1: 74,590,685 R224C probably damaging Het
Car2 T C 3: 14,886,650 probably benign Het
Cbln1 T C 8: 87,472,029 N71S probably benign Het
Cdh8 T A 8: 99,223,947 T224S probably benign Het
Cep131 G A 11: 120,065,392 R1014W probably damaging Het
Cfap61 T C 2: 146,045,443 S603P possibly damaging Het
Chd8 G T 14: 52,226,668 L659I probably benign Het
Ckap5 G A 2: 91,557,575 G255D probably benign Het
Clec18a C A 8: 111,080,940 W126L probably benign Het
Cux1 T A 5: 136,567,231 N4Y probably damaging Het
Dgcr8 A T 16: 18,283,829 Y196* probably null Het
Dnah14 A T 1: 181,641,405 I1267F probably benign Het
Dock7 T C 4: 99,061,292 N438D probably benign Het
Dock8 A T 19: 25,183,022 H1763L possibly damaging Het
Fpr-rs6 A T 17: 20,182,838 M87K possibly damaging Het
Gabrg1 A G 5: 70,754,267 S339P probably benign Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Gm11487 A T 4: 73,403,606 M64K possibly damaging Het
Gm12695 A G 4: 96,762,821 S132P probably damaging Het
Gm3443 T A 19: 21,555,764 C31S probably damaging Het
Gm9573 T C 17: 35,623,165 probably benign Het
Gzmf A T 14: 56,206,995 F40L probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Ikbkap T C 4: 56,771,555 D914G possibly damaging Het
Lrguk A G 6: 34,095,587 E604G probably benign Het
Marveld3 C A 8: 109,948,100 K361N probably benign Het
Mgat4b A T 11: 50,230,698 Y47F probably damaging Het
Mmel1 G T 4: 154,892,428 E520* probably null Het
Myod1 A G 7: 46,378,317 T294A probably benign Het
Nfix A T 8: 84,727,647 S219T probably damaging Het
Nr4a2 A G 2: 57,111,908 F115L probably benign Het
Numa1 A C 7: 101,992,638 M98L probably benign Het
P3h1 C T 4: 119,237,954 L303F possibly damaging Het
Pias4 G A 10: 81,157,246 T5I probably damaging Het
Pik3ip1 A G 11: 3,332,124 N68S probably benign Het
Pkdrej T C 15: 85,818,649 T1029A probably benign Het
Recql A T 6: 142,364,552 D517E probably benign Het
Sall2 G T 14: 52,314,621 H372Q probably damaging Het
Scn8a A C 15: 101,032,215 I1436L probably benign Het
Slc4a5 T C 6: 83,296,747 probably null Het
Stox2 A C 8: 47,186,465 F898C probably damaging Het
Sumo2 A T 11: 115,523,775 probably null Het
Sycp2 C T 2: 178,383,552 E366K possibly damaging Het
Tanc1 A G 2: 59,791,806 K423R probably benign Het
Tbx21 T A 11: 97,115,046 Q31L possibly damaging Het
Tcrg-C1 A T 13: 19,216,476 D125V unknown Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tfdp1 C T 8: 13,370,485 R105W probably damaging Het
Trav18 G A 14: 53,831,665 V55I probably benign Het
Trim55 A G 3: 19,672,774 D335G probably benign Het
Trim71 T A 9: 114,512,704 T837S probably benign Het
Vmn1r56 T C 7: 5,195,962 T219A probably benign Het
Vmn2r17 A T 5: 109,427,829 T189S probably benign Het
Xaf1 A G 11: 72,306,635 T146A probably benign Het
Zdbf2 T C 1: 63,304,520 V686A possibly damaging Het
Zfp65 T C 13: 67,708,011 H383R probably damaging Het
Zfp932 A G 5: 110,009,740 T435A probably damaging Het
Zfp947 C T 17: 22,145,769 G308D probably benign Het
Zswim3 T A 2: 164,820,851 V417E probably damaging Het
Other mutations in Olfr1458
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Olfr1458 APN 19 13102989 missense possibly damaging 0.93
IGL02319:Olfr1458 APN 19 13102662 missense probably benign 0.14
IGL02926:Olfr1458 APN 19 13102823 missense possibly damaging 0.74
IGL03107:Olfr1458 APN 19 13103037 missense probably benign
IGL03304:Olfr1458 APN 19 13102741 missense probably damaging 1.00
R0046:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0049:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0099:Olfr1458 UTSW 19 13103140 missense probably benign 0.07
R0103:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0144:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0189:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0206:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0207:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0208:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0212:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0344:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0426:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0506:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0507:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0607:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0661:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R0734:Olfr1458 UTSW 19 13103278 missense possibly damaging 0.76
R1347:Olfr1458 UTSW 19 13102690 missense probably benign 0.03
R1347:Olfr1458 UTSW 19 13102690 missense probably benign 0.03
R1443:Olfr1458 UTSW 19 13103204 nonsense probably null
R1446:Olfr1458 UTSW 19 13103016 missense possibly damaging 0.59
R1567:Olfr1458 UTSW 19 13102642 missense probably benign 0.00
R2190:Olfr1458 UTSW 19 13102493 missense probably damaging 1.00
R2438:Olfr1458 UTSW 19 13102421 missense probably benign 0.00
R4020:Olfr1458 UTSW 19 13102426 missense probably damaging 0.99
R4406:Olfr1458 UTSW 19 13102594 missense possibly damaging 0.70
R4631:Olfr1458 UTSW 19 13103272 missense probably benign 0.07
R4847:Olfr1458 UTSW 19 13102534 missense probably damaging 1.00
R4979:Olfr1458 UTSW 19 13102689 missense probably damaging 0.97
R6086:Olfr1458 UTSW 19 13102381 makesense probably null
R6480:Olfr1458 UTSW 19 13102474 missense probably benign 0.34
R6484:Olfr1458 UTSW 19 13103067 missense probably benign 0.34
R7121:Olfr1458 UTSW 19 13103173 missense probably benign 0.03
R7547:Olfr1458 UTSW 19 13103043 missense not run
X0024:Olfr1458 UTSW 19 13103209 missense probably benign 0.22
X0027:Olfr1458 UTSW 19 13103224 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TTTTCCACGTTGGCAAAGTTTG -3'
(R):5'- GGGCTTCTAACCACTAAAACATCTC -3'

Sequencing Primer
(F):5'- GGCACAAGCATTGTAGGACATCATC -3'
(R):5'- ATCTCTCAAACCCCCATTCTAC -3'
Posted On2018-08-29