Mutagenetix > Incidental Mutation

Incidental Mutation 'R6787:Mphosph9'

532428

Institutional Source

Beutler Lab

Gene Symbol

Mphosph9

Ensembl Gene

ENSMUSG00000038126

Gene Name

M-phase phosphoprotein 9

Synonyms

MPP-9, MPP9, B930097C17Rik, 9630025B04Rik, 4930548D04Rik

MMRRC Submission

044901-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6787 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124250959-124327972 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 124261027 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 975 (I975T)

Ref Sequence

ENSEMBL: ENSMUSP00000138982 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031344] [ENSMUST00000147737] [ENSMUST00000184951]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031344
AA Change: I945T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000031344
Gene: ENSMUSG00000038126
AA Change: I945T

Domain	Start	End	E-Value	Type
low complexity region	102	119	N/A	INTRINSIC
low complexity region	128	140	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
coiled coil region	574	736	N/A	INTRINSIC
low complexity region	879	898	N/A	INTRINSIC
low complexity region	957	971	N/A	INTRINSIC
coiled coil region	1040	1105	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147737

Predicted Effect

probably damaging
Transcript: ENSMUST00000184951
AA Change: I975T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138982
Gene: ENSMUSG00000038126
AA Change: I975T

Domain	Start	End	E-Value	Type
coiled coil region	102	130	N/A	INTRINSIC
low complexity region	132	149	N/A	INTRINSIC
low complexity region	158	170	N/A	INTRINSIC
low complexity region	444	458	N/A	INTRINSIC
coiled coil region	604	766	N/A	INTRINSIC
low complexity region	909	928	N/A	INTRINSIC
low complexity region	987	1001	N/A	INTRINSIC
coiled coil region	1070	1135	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.3%

Validation Efficiency

96% (51/53)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700097O09Rik	G	A	12: 55,079,983	T32I	probably benign	Het
4930486L24Rik	T	A	13: 60,853,108	I205L	probably benign	Het
Aatk	C	T	11: 120,010,682	V963M	probably damaging	Het
Adra1b	C	A	11: 43,835,415	R225L	probably damaging	Het
Adrb1	T	C	19: 56,722,589	V73A	probably damaging	Het
Akt3	A	T	1: 177,050,190	Y337*	probably null	Het
BC035947	G	T	1: 78,498,890	P335Q	possibly damaging	Het
C2cd3	T	C	7: 100,455,346	F2189L	probably benign	Het
Capn9	A	G	8: 124,616,185	I635V	probably benign	Het
Cep55	T	A	19: 38,057,926	D42E	probably benign	Het
Cftr	T	A	6: 18,274,608	Y878*	probably null	Het
Clpb	A	T	7: 101,663,659		probably benign	Het
Cpeb3	T	C	19: 37,044,689	I569V	possibly damaging	Het
Cpne6	A	T	14: 55,515,244	D297V	probably damaging	Het
Ddhd1	T	C	14: 45,657,519	T165A	probably benign	Het
Fam98b	T	C	2: 117,262,921		probably null	Het
Frem2	T	C	3: 53,654,323	N921S	probably benign	Het
Gbf1	T	A	19: 46,271,772	V1039E	probably benign	Het
Gmip	A	G	8: 69,813,786	E212G	probably damaging	Het
Gpcpd1	C	T	2: 132,537,838		probably benign	Het
Gtf2ird1	A	T	5: 134,363,912	N796K	probably damaging	Het
Hadhb	T	C	5: 30,155,249		probably benign	Het
Itga4	T	A	2: 79,289,265	S472T	probably damaging	Het
Kcna4	G	A	2: 107,295,325	E135K	possibly damaging	Het
Kmt2c	G	T	5: 25,275,739		probably null	Het
Lama1	T	C	17: 67,784,025	I1620T	unknown	Het
Lins1	A	G	7: 66,714,154	E594G	probably benign	Het
Lrrc38	T	A	4: 143,369,794	M225K	probably benign	Het
Mrgprh	T	C	17: 12,876,987	F38S	probably benign	Het
Myo1h	G	A	5: 114,320,653	G150R	probably damaging	Het
Oas2	T	G	5: 120,738,798	I391L	possibly damaging	Het
Olfr1242	T	A	2: 89,494,034	R93*	probably null	Het
Olfr18	T	C	9: 20,335,925	D14G	probably benign	Het
Olfr497	T	C	7: 108,422,682	I37T	possibly damaging	Het
Olfr803	T	A	10: 129,691,522	D173V	possibly damaging	Het
Pdcd5	T	C	7: 35,642,638	T182A	probably damaging	Het
Pdlim7	T	C	13: 55,508,997	D48G	probably damaging	Het
Polr3b	A	C	10: 84,628,625		probably null	Het
Psmd5	C	T	2: 34,857,637		probably null	Het
Rsf1	GGCG	GGCGACGGCCGCG	7: 97,579,906		probably benign	Homo
Sdhb	T	C	4: 140,976,190	Y208H	probably damaging	Het
Serinc5	G	A	13: 92,706,232	V397I	possibly damaging	Het
Sik2	A	T	9: 50,998,534	M73K	possibly damaging	Het
Slc41a1	A	G	1: 131,842,749		probably null	Het
Slco1a1	T	C	6: 141,936,487	I119V	probably benign	Het
Srd5a1	T	C	13: 69,611,299		probably benign	Het
Stab2	T	C	10: 86,919,084	I1111V	probably benign	Het
Stxbp6	G	T	12: 44,902,996		probably null	Het
Tbc1d19	A	G	5: 53,835,249		probably null	Het
Tnxb	A	T	17: 34,710,736	T2815S	probably benign	Het
Txnip	T	A	3: 96,560,307	I363N	probably damaging	Het
Zfp442	A	T	2: 150,409,579	N134K	possibly damaging	Het

Other mutations in Mphosph9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Mphosph9	APN	5	124262021	missense	probably damaging	1.00
IGL01527:Mphosph9	APN	5	124283624	splice site	probably benign
IGL01784:Mphosph9	APN	5	124265310	splice site	probably benign
IGL01958:Mphosph9	APN	5	124324990	utr 5 prime	probably benign
IGL02020:Mphosph9	APN	5	124258950	missense	probably damaging	0.99
IGL02190:Mphosph9	APN	5	124265425	missense	possibly damaging	0.92
IGL02261:Mphosph9	APN	5	124260087	missense	probably damaging	1.00
IGL02569:Mphosph9	APN	5	124297571	nonsense	probably null
IGL02640:Mphosph9	APN	5	124315500	missense	possibly damaging	0.66
IGL02702:Mphosph9	APN	5	124259989	missense	probably damaging	1.00
IGL02793:Mphosph9	APN	5	124283737	critical splice acceptor site	probably null
IGL02813:Mphosph9	APN	5	124315628	missense	probably benign	0.37
IGL02875:Mphosph9	APN	5	124283737	critical splice acceptor site	probably null
IGL03149:Mphosph9	APN	5	124263011	missense	probably damaging	1.00
PIT4445001:Mphosph9	UTSW	5	124298790	missense	possibly damaging	0.82
R0304:Mphosph9	UTSW	5	124298829	missense	probably benign	0.01
R0437:Mphosph9	UTSW	5	124315568	missense	probably benign	0.27
R0483:Mphosph9	UTSW	5	124306970	nonsense	probably null
R0811:Mphosph9	UTSW	5	124298759	missense	probably damaging	1.00
R0812:Mphosph9	UTSW	5	124298759	missense	probably damaging	1.00
R0942:Mphosph9	UTSW	5	124262037	nonsense	probably null
R1175:Mphosph9	UTSW	5	124315676	missense	possibly damaging	0.94
R1372:Mphosph9	UTSW	5	124283745	splice site	probably null
R1442:Mphosph9	UTSW	5	124265398	missense	possibly damaging	0.62
R1533:Mphosph9	UTSW	5	124267141	missense	probably damaging	1.00
R1959:Mphosph9	UTSW	5	124315701	missense	possibly damaging	0.92
R2036:Mphosph9	UTSW	5	124304211	missense	probably damaging	0.97
R2256:Mphosph9	UTSW	5	124283659	missense	probably benign	0.00
R2919:Mphosph9	UTSW	5	124261006	missense	probably benign	0.22
R2920:Mphosph9	UTSW	5	124261006	missense	probably benign	0.22
R4064:Mphosph9	UTSW	5	124290917	missense	probably damaging	1.00
R4272:Mphosph9	UTSW	5	124304203	missense	probably damaging	0.96
R4430:Mphosph9	UTSW	5	124265446	missense	possibly damaging	0.83
R4883:Mphosph9	UTSW	5	124299045	missense	probably damaging	1.00
R4992:Mphosph9	UTSW	5	124304190	missense	probably damaging	1.00
R5815:Mphosph9	UTSW	5	124315418	missense	probably damaging	1.00
R5993:Mphosph9	UTSW	5	124316098	missense	probably benign	0.40
R6102:Mphosph9	UTSW	5	124297709	missense	possibly damaging	0.86
R6295:Mphosph9	UTSW	5	124320915	missense	possibly damaging	0.46
R6320:Mphosph9	UTSW	5	124324961	missense	probably damaging	0.99
R6628:Mphosph9	UTSW	5	124298762	missense	probably damaging	0.98
R6692:Mphosph9	UTSW	5	124260116	missense	probably damaging	1.00
R6705:Mphosph9	UTSW	5	124290964	missense	possibly damaging	0.83
R6747:Mphosph9	UTSW	5	124297699	missense	possibly damaging	0.93
R6850:Mphosph9	UTSW	5	124260956	missense	probably damaging	1.00
R6956:Mphosph9	UTSW	5	124297558	missense	probably damaging	1.00
R7075:Mphosph9	UTSW	5	124320859	missense	probably damaging	0.99
R7604:Mphosph9	UTSW	5	124316117	missense	probably benign	0.01
R7789:Mphosph9	UTSW	5	124315587	missense	probably damaging	1.00
R7808:Mphosph9	UTSW	5	124260946	missense	probably damaging	0.99
R7823:Mphosph9	UTSW	5	124304256	missense	probably damaging	0.99
R7891:Mphosph9	UTSW	5	124290904	missense	probably damaging	1.00
R8210:Mphosph9	UTSW	5	124267111	missense	probably damaging	1.00
R8256:Mphosph9	UTSW	5	124255106	missense	probably damaging	1.00
R8385:Mphosph9	UTSW	5	124312722	missense	probably benign	0.19
R8438:Mphosph9	UTSW	5	124292392	missense	probably benign	0.19
R8692:Mphosph9	UTSW	5	124312812	missense	probably damaging	0.99
R8790:Mphosph9	UTSW	5	124315673	missense	probably damaging	1.00
R8818:Mphosph9	UTSW	5	124324964	nonsense	probably null
R8847:Mphosph9	UTSW	5	124316146	missense	possibly damaging	0.91
R9018:Mphosph9	UTSW	5	124298650	missense	probably benign	0.12
R9208:Mphosph9	UTSW	5	124312791	missense	probably damaging	0.97
R9221:Mphosph9	UTSW	5	124265364	missense	probably benign	0.10
R9603:Mphosph9	UTSW	5	124324952	nonsense	probably null
R9721:Mphosph9	UTSW	5	124298675	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- GTGACAATCAGCACCCGTACAG -3'
(R):5'- TGTCAGGAAAGCCAGGTTCC -3'

Sequencing Primer
(F):5'- TCAGGCAGAGACCATCTTCAGAG -3'
(R):5'- CGTGCCAGCTTTGTCAGTCAATATG -3'

Posted On

2018-08-29