Incidental Mutation 'R6787:Gmip'
ID532438
Institutional Source Beutler Lab
Gene Symbol Gmip
Ensembl Gene ENSMUSG00000036246
Gene NameGem-interacting protein
Synonyms5031419I10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R6787 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location69808679-69821870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69813786 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 212 (E212G)
Ref Sequence ENSEMBL: ENSMUSP00000116542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036074] [ENSMUST00000123453]
Predicted Effect probably damaging
Transcript: ENSMUST00000036074
AA Change: E212G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045676
Gene: ENSMUSG00000036246
AA Change: E212G

DomainStartEndE-ValueType
PDB:3QWE|A 85 356 1e-149 PDB
low complexity region 358 367 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
C1 491 536 1.75e-6 SMART
RhoGAP 561 753 1.06e-61 SMART
Blast:RhoGAP 824 971 1e-53 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000123453
AA Change: E212G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116542
Gene: ENSMUSG00000036246
AA Change: E212G

DomainStartEndE-ValueType
PDB:3QWE|A 85 356 1e-150 PDB
low complexity region 358 367 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
C1 491 536 1.75e-6 SMART
RhoGAP 561 753 1.06e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142659
SMART Domains Protein: ENSMUSP00000114525
Gene: ENSMUSG00000036246

DomainStartEndE-ValueType
Blast:RhoGAP 2 25 1e-7 BLAST
SCOP:d1f7ca_ 3 32 7e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ARHGAP family of Rho/Rac/Cdc42-like GTPase activating proteins. The encoded protein interacts with the Ras-related protein Gem through its N-terminal domain. Separately, it interacts with RhoA through a RhoGAP domain, and stimulates RhoA-dependent GTPase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik G A 12: 55,079,983 T32I probably benign Het
4930486L24Rik T A 13: 60,853,108 I205L probably benign Het
Aatk C T 11: 120,010,682 V963M probably damaging Het
Adra1b C A 11: 43,835,415 R225L probably damaging Het
Adrb1 T C 19: 56,722,589 V73A probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
BC035947 G T 1: 78,498,890 P335Q possibly damaging Het
C2cd3 T C 7: 100,455,346 F2189L probably benign Het
Capn9 A G 8: 124,616,185 I635V probably benign Het
Cep55 T A 19: 38,057,926 D42E probably benign Het
Cftr T A 6: 18,274,608 Y878* probably null Het
Clpb A T 7: 101,663,659 probably benign Het
Cpeb3 T C 19: 37,044,689 I569V possibly damaging Het
Cpne6 A T 14: 55,515,244 D297V probably damaging Het
Ddhd1 T C 14: 45,657,519 T165A probably benign Het
Fam98b T C 2: 117,262,921 probably null Het
Frem2 T C 3: 53,654,323 N921S probably benign Het
Gbf1 T A 19: 46,271,772 V1039E probably benign Het
Gpcpd1 C T 2: 132,537,838 probably benign Het
Gtf2ird1 A T 5: 134,363,912 N796K probably damaging Het
Hadhb T C 5: 30,155,249 probably benign Het
Itga4 T A 2: 79,289,265 S472T probably damaging Het
Kcna4 G A 2: 107,295,325 E135K possibly damaging Het
Kmt2c G T 5: 25,275,739 probably null Het
Lama1 T C 17: 67,784,025 I1620T unknown Het
Lins1 A G 7: 66,714,154 E594G probably benign Het
Lrrc38 T A 4: 143,369,794 M225K probably benign Het
Mphosph9 A G 5: 124,261,027 I975T probably damaging Het
Mrgprh T C 17: 12,876,987 F38S probably benign Het
Myo1h G A 5: 114,320,653 G150R probably damaging Het
Oas2 T G 5: 120,738,798 I391L possibly damaging Het
Olfr1242 T A 2: 89,494,034 R93* probably null Het
Olfr18 T C 9: 20,335,925 D14G probably benign Het
Olfr497 T C 7: 108,422,682 I37T possibly damaging Het
Olfr803 T A 10: 129,691,522 D173V possibly damaging Het
Pdcd5 T C 7: 35,642,638 T182A probably damaging Het
Pdlim7 T C 13: 55,508,997 D48G probably damaging Het
Polr3b A C 10: 84,628,625 probably null Het
Psmd5 C T 2: 34,857,637 probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Sdhb T C 4: 140,976,190 Y208H probably damaging Het
Serinc5 G A 13: 92,706,232 V397I possibly damaging Het
Sik2 A T 9: 50,998,534 M73K possibly damaging Het
Slc41a1 A G 1: 131,842,749 probably null Het
Slco1a1 T C 6: 141,936,487 I119V probably benign Het
Srd5a1 T C 13: 69,611,299 probably benign Het
Stab2 T C 10: 86,919,084 I1111V probably benign Het
Stxbp6 G T 12: 44,902,996 probably null Het
Tbc1d19 A G 5: 53,835,249 probably null Het
Tnxb A T 17: 34,710,736 T2815S probably benign Het
Txnip T A 3: 96,560,307 I363N probably damaging Het
Zfp442 A T 2: 150,409,579 N134K possibly damaging Het
Other mutations in Gmip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Gmip APN 8 69817011 nonsense probably null
IGL02529:Gmip APN 8 69816789 missense probably damaging 0.99
IGL03185:Gmip APN 8 69809783 missense probably benign 0.02
IGL03328:Gmip APN 8 69811611 missense possibly damaging 0.79
microdot UTSW 8 69814135 missense probably damaging 1.00
minnox UTSW 8 69817802 missense probably benign 0.02
puncta UTSW 8 69816086 missense possibly damaging 0.50
R0110:Gmip UTSW 8 69815609 unclassified probably benign
R0329:Gmip UTSW 8 69810818 missense probably benign 0.06
R0330:Gmip UTSW 8 69810818 missense probably benign 0.06
R0510:Gmip UTSW 8 69815609 unclassified probably benign
R0638:Gmip UTSW 8 69811445 splice site probably benign
R1692:Gmip UTSW 8 69813903 missense probably benign
R1721:Gmip UTSW 8 69811232 missense probably damaging 0.96
R1755:Gmip UTSW 8 69814124 missense probably damaging 1.00
R1801:Gmip UTSW 8 69814477 missense probably benign
R1894:Gmip UTSW 8 69820972 missense probably damaging 1.00
R1926:Gmip UTSW 8 69815520 missense probably benign 0.41
R2005:Gmip UTSW 8 69814043 missense probably benign
R4280:Gmip UTSW 8 69813601 unclassified probably benign
R4281:Gmip UTSW 8 69813601 unclassified probably benign
R4282:Gmip UTSW 8 69813601 unclassified probably benign
R4283:Gmip UTSW 8 69813601 unclassified probably benign
R5221:Gmip UTSW 8 69814135 missense probably damaging 1.00
R5512:Gmip UTSW 8 69817890 missense probably benign 0.00
R5521:Gmip UTSW 8 69817399 missense probably damaging 1.00
R5763:Gmip UTSW 8 69817851 missense probably damaging 1.00
R6151:Gmip UTSW 8 69817085 missense probably damaging 1.00
R6163:Gmip UTSW 8 69817372 missense probably benign 0.28
R6228:Gmip UTSW 8 69816123 missense probably damaging 1.00
R6775:Gmip UTSW 8 69815635 missense possibly damaging 0.82
R6788:Gmip UTSW 8 69811174 missense possibly damaging 0.87
R6788:Gmip UTSW 8 69811176 missense probably damaging 1.00
R6852:Gmip UTSW 8 69817991 nonsense probably null
R6934:Gmip UTSW 8 69820926 missense probably benign
R7010:Gmip UTSW 8 69811400 missense probably damaging 1.00
R7122:Gmip UTSW 8 69817802 missense probably benign 0.02
R7254:Gmip UTSW 8 69816468 splice site probably null
R7351:Gmip UTSW 8 69817384 missense probably benign 0.01
R7360:Gmip UTSW 8 69811242 missense probably damaging 1.00
R7412:Gmip UTSW 8 69820499 missense probably benign
R7577:Gmip UTSW 8 69814435 missense probably benign 0.17
R7718:Gmip UTSW 8 69817733 missense probably damaging 0.99
R8018:Gmip UTSW 8 69815493 missense probably benign 0.41
R8080:Gmip UTSW 8 69816086 missense possibly damaging 0.50
X0063:Gmip UTSW 8 69809816 missense probably damaging 1.00
Z1176:Gmip UTSW 8 69816292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGGGTTCGGGTCTAAGG -3'
(R):5'- TACTGTGTTTCCGACCTTGG -3'

Sequencing Primer
(F):5'- AACAGCAGATGGGGCTCCTG -3'
(R):5'- TCCGACCTTGGCCTGTG -3'
Posted On2018-08-29