Incidental Mutation 'R6787:Stab2'
ID 532443
Institutional Source Beutler Lab
Gene Symbol Stab2
Ensembl Gene ENSMUSG00000035459
Gene Name stabilin 2
Synonyms FEEL-2, STAB-2
MMRRC Submission 044901-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6787 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 86677062-86843889 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86754948 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1111 (I1111V)
Ref Sequence ENSEMBL: ENSMUSP00000048309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035288]
AlphaFold Q8R4U0
Predicted Effect probably benign
Transcript: ENSMUST00000035288
AA Change: I1111V

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: I1111V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF 119 156 1.85e0 SMART
EGF 167 201 2.43e1 SMART
EGF 206 244 1.43e-1 SMART
EGF 248 284 3.82e-2 SMART
EGF 333 370 2.02e-1 SMART
FAS1 414 515 1.06e-8 SMART
FAS1 561 662 3.54e-19 SMART
EGF 746 783 6.76e-3 SMART
EGF 836 873 1.31e0 SMART
EGF 877 917 2.99e-4 SMART
EGF 921 960 3.51e-1 SMART
EGF 964 1002 1.99e0 SMART
FAS1 1038 1138 1.73e-13 SMART
FAS1 1181 1276 1.83e-12 SMART
EGF 1354 1391 6.92e0 SMART
EGF 1401 1435 1.11e1 SMART
EGF 1442 1477 3.01e0 SMART
EGF 1481 1519 1.64e-1 SMART
EGF 1523 1561 1.14e0 SMART
EGF 1565 1603 5.62e0 SMART
FAS1 1638 1734 2.23e-25 SMART
FAS1 1785 1891 6.92e-22 SMART
EGF 1966 2006 1.95e1 SMART
EGF_like 1977 2017 2.46e-1 SMART
EGF 2016 2050 1.14e0 SMART
EGF 2058 2089 1.56e1 SMART
EGF 2093 2130 1.36e1 SMART
EGF 2134 2173 2.13e0 SMART
LINK 2204 2298 2.08e-29 SMART
FAS1 2363 2455 3.19e-12 SMART
transmembrane domain 2467 2489 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik G A 12: 55,126,768 (GRCm39) T32I probably benign Het
4930486L24Rik T A 13: 61,000,922 (GRCm39) I205L probably benign Het
Aatk C T 11: 119,901,508 (GRCm39) V963M probably damaging Het
Adra1b C A 11: 43,726,242 (GRCm39) R225L probably damaging Het
Adrb1 T C 19: 56,711,021 (GRCm39) V73A probably damaging Het
Akt3 A T 1: 176,877,756 (GRCm39) Y337* probably null Het
BC035947 G T 1: 78,475,527 (GRCm39) P335Q possibly damaging Het
C2cd3 T C 7: 100,104,553 (GRCm39) F2189L probably benign Het
Capn9 A G 8: 125,342,924 (GRCm39) I635V probably benign Het
Cep55 T A 19: 38,046,374 (GRCm39) D42E probably benign Het
Cftr T A 6: 18,274,607 (GRCm39) Y878* probably null Het
Clpb A T 7: 101,312,866 (GRCm39) probably benign Het
Cpeb3 T C 19: 37,022,089 (GRCm39) I569V possibly damaging Het
Cpne6 A T 14: 55,752,701 (GRCm39) D297V probably damaging Het
Ddhd1 T C 14: 45,894,976 (GRCm39) T165A probably benign Het
Fam98b T C 2: 117,093,402 (GRCm39) probably null Het
Frem2 T C 3: 53,561,744 (GRCm39) N921S probably benign Het
Gbf1 T A 19: 46,260,211 (GRCm39) V1039E probably benign Het
Gmip A G 8: 70,266,436 (GRCm39) E212G probably damaging Het
Gpcpd1 C T 2: 132,379,758 (GRCm39) probably benign Het
Gtf2ird1 A T 5: 134,392,766 (GRCm39) N796K probably damaging Het
Hadhb T C 5: 30,360,247 (GRCm39) probably benign Het
Itga4 T A 2: 79,119,609 (GRCm39) S472T probably damaging Het
Kcna4 G A 2: 107,125,670 (GRCm39) E135K possibly damaging Het
Kmt2c G T 5: 25,480,737 (GRCm39) probably null Het
Lama1 T C 17: 68,091,020 (GRCm39) I1620T unknown Het
Lins1 A G 7: 66,363,902 (GRCm39) E594G probably benign Het
Lrrc38 T A 4: 143,096,364 (GRCm39) M225K probably benign Het
Mphosph9 A G 5: 124,399,090 (GRCm39) I975T probably damaging Het
Mrgprh T C 17: 13,095,874 (GRCm39) F38S probably benign Het
Myo1h G A 5: 114,458,714 (GRCm39) G150R probably damaging Het
Oas2 T G 5: 120,876,863 (GRCm39) I391L possibly damaging Het
Or4a70 T A 2: 89,324,378 (GRCm39) R93* probably null Het
Or5p72 T C 7: 108,021,889 (GRCm39) I37T possibly damaging Het
Or6c3b T A 10: 129,527,391 (GRCm39) D173V possibly damaging Het
Or7e178 T C 9: 20,247,221 (GRCm39) D14G probably benign Het
Pdcd5 T C 7: 35,342,063 (GRCm39) T182A probably damaging Het
Pdlim7 T C 13: 55,656,810 (GRCm39) D48G probably damaging Het
Polr3b A C 10: 84,464,489 (GRCm39) probably null Het
Psmd5 C T 2: 34,747,649 (GRCm39) probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,229,113 (GRCm39) probably benign Homo
Sdhb T C 4: 140,703,501 (GRCm39) Y208H probably damaging Het
Serinc5 G A 13: 92,842,740 (GRCm39) V397I possibly damaging Het
Sik2 A T 9: 50,909,834 (GRCm39) M73K possibly damaging Het
Slc41a1 A G 1: 131,770,487 (GRCm39) probably null Het
Slco1a1 T C 6: 141,882,213 (GRCm39) I119V probably benign Het
Srd5a1 T C 13: 69,759,418 (GRCm39) probably benign Het
Stxbp6 G T 12: 44,949,779 (GRCm39) probably null Het
Tbc1d19 A G 5: 53,992,591 (GRCm39) probably null Het
Tnxb A T 17: 34,929,710 (GRCm39) T2815S probably benign Het
Txnip T A 3: 96,467,623 (GRCm39) I363N probably damaging Het
Zfp442 A T 2: 150,251,499 (GRCm39) N134K possibly damaging Het
Other mutations in Stab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Stab2 APN 10 86,705,070 (GRCm39) splice site probably null
IGL00809:Stab2 APN 10 86,684,038 (GRCm39) splice site probably benign
IGL00911:Stab2 APN 10 86,805,617 (GRCm39) missense probably damaging 1.00
IGL01347:Stab2 APN 10 86,737,567 (GRCm39) splice site probably null
IGL01411:Stab2 APN 10 86,815,872 (GRCm39) splice site probably benign
IGL01503:Stab2 APN 10 86,776,477 (GRCm39) splice site probably benign
IGL01599:Stab2 APN 10 86,758,759 (GRCm39) missense probably damaging 1.00
IGL01635:Stab2 APN 10 86,816,992 (GRCm39) missense probably benign 0.04
IGL01640:Stab2 APN 10 86,790,035 (GRCm39) missense probably benign 0.09
IGL01671:Stab2 APN 10 86,805,141 (GRCm39) missense possibly damaging 0.80
IGL02023:Stab2 APN 10 86,707,695 (GRCm39) missense possibly damaging 0.67
IGL02075:Stab2 APN 10 86,803,514 (GRCm39) missense possibly damaging 0.71
IGL02174:Stab2 APN 10 86,695,606 (GRCm39) splice site probably null
IGL02600:Stab2 APN 10 86,790,123 (GRCm39) missense probably damaging 1.00
IGL02666:Stab2 APN 10 86,686,766 (GRCm39) missense possibly damaging 0.67
IGL02668:Stab2 APN 10 86,682,027 (GRCm39) splice site probably benign
IGL02709:Stab2 APN 10 86,682,029 (GRCm39) splice site probably benign
IGL02728:Stab2 APN 10 86,692,420 (GRCm39) missense possibly damaging 0.95
IGL02803:Stab2 APN 10 86,786,133 (GRCm39) splice site probably benign
IGL02938:Stab2 APN 10 86,707,785 (GRCm39) missense possibly damaging 0.77
IGL03033:Stab2 APN 10 86,832,667 (GRCm39) critical splice donor site probably null
IGL03238:Stab2 APN 10 86,690,985 (GRCm39) missense probably damaging 1.00
IGL03402:Stab2 APN 10 86,805,165 (GRCm39) missense probably benign 0.03
prospector UTSW 10 86,737,431 (GRCm39) splice site probably null
songbird UTSW 10 86,694,016 (GRCm39) missense probably damaging 1.00
3-1:Stab2 UTSW 10 86,705,041 (GRCm39) missense probably damaging 0.96
F6893:Stab2 UTSW 10 86,691,035 (GRCm39) missense probably damaging 1.00
K7371:Stab2 UTSW 10 86,779,153 (GRCm39) critical splice donor site probably null
PIT4142001:Stab2 UTSW 10 86,703,039 (GRCm39) missense possibly damaging 0.94
PIT4362001:Stab2 UTSW 10 86,697,299 (GRCm39) nonsense probably null
R0015:Stab2 UTSW 10 86,679,481 (GRCm39) missense probably benign
R0254:Stab2 UTSW 10 86,733,824 (GRCm39) missense probably benign
R0310:Stab2 UTSW 10 86,803,477 (GRCm39) splice site probably benign
R0333:Stab2 UTSW 10 86,677,491 (GRCm39) missense probably benign
R0391:Stab2 UTSW 10 86,783,008 (GRCm39) missense probably benign 0.27
R0400:Stab2 UTSW 10 86,708,474 (GRCm39) missense probably damaging 1.00
R0433:Stab2 UTSW 10 86,679,355 (GRCm39) splice site probably benign
R0440:Stab2 UTSW 10 86,785,792 (GRCm39) missense probably benign 0.23
R0743:Stab2 UTSW 10 86,723,759 (GRCm39) missense probably damaging 1.00
R0847:Stab2 UTSW 10 86,805,735 (GRCm39) missense probably benign 0.00
R0883:Stab2 UTSW 10 86,760,314 (GRCm39) splice site probably benign
R1078:Stab2 UTSW 10 86,742,997 (GRCm39) splice site probably null
R1118:Stab2 UTSW 10 86,721,582 (GRCm39) splice site probably null
R1119:Stab2 UTSW 10 86,695,619 (GRCm39) missense possibly damaging 0.51
R1179:Stab2 UTSW 10 86,786,165 (GRCm39) missense probably damaging 0.98
R1440:Stab2 UTSW 10 86,697,231 (GRCm39) splice site probably null
R1550:Stab2 UTSW 10 86,714,790 (GRCm39) missense probably benign 0.01
R1616:Stab2 UTSW 10 86,721,582 (GRCm39) splice site probably null
R1728:Stab2 UTSW 10 86,773,903 (GRCm39) missense probably benign 0.41
R1768:Stab2 UTSW 10 86,838,872 (GRCm39) missense probably damaging 1.00
R1772:Stab2 UTSW 10 86,790,098 (GRCm39) missense probably benign 0.06
R1776:Stab2 UTSW 10 86,793,680 (GRCm39) missense possibly damaging 0.92
R1784:Stab2 UTSW 10 86,773,903 (GRCm39) missense probably benign 0.41
R1892:Stab2 UTSW 10 86,773,913 (GRCm39) missense probably damaging 0.99
R1957:Stab2 UTSW 10 86,697,334 (GRCm39) missense probably benign 0.13
R1972:Stab2 UTSW 10 86,796,180 (GRCm39) missense probably damaging 0.99
R1975:Stab2 UTSW 10 86,732,360 (GRCm39) critical splice donor site probably null
R1976:Stab2 UTSW 10 86,732,360 (GRCm39) critical splice donor site probably null
R1996:Stab2 UTSW 10 86,838,895 (GRCm39) missense probably damaging 1.00
R2085:Stab2 UTSW 10 86,790,023 (GRCm39) missense probably damaging 1.00
R2149:Stab2 UTSW 10 86,700,904 (GRCm39) nonsense probably null
R2169:Stab2 UTSW 10 86,723,726 (GRCm39) missense probably damaging 1.00
R2201:Stab2 UTSW 10 86,776,503 (GRCm39) missense probably benign 0.22
R2296:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2297:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2298:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2326:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2434:Stab2 UTSW 10 86,805,183 (GRCm39) missense possibly damaging 0.78
R2519:Stab2 UTSW 10 86,770,704 (GRCm39) splice site probably benign
R2696:Stab2 UTSW 10 86,697,363 (GRCm39) missense probably benign 0.45
R2883:Stab2 UTSW 10 86,803,550 (GRCm39) missense possibly damaging 0.92
R2923:Stab2 UTSW 10 86,697,325 (GRCm39) missense probably damaging 1.00
R3711:Stab2 UTSW 10 86,702,572 (GRCm39) missense probably damaging 1.00
R3787:Stab2 UTSW 10 86,805,141 (GRCm39) missense possibly damaging 0.50
R3834:Stab2 UTSW 10 86,785,776 (GRCm39) missense possibly damaging 0.87
R3970:Stab2 UTSW 10 86,714,750 (GRCm39) missense probably damaging 0.97
R3979:Stab2 UTSW 10 86,699,320 (GRCm39) missense possibly damaging 0.56
R4003:Stab2 UTSW 10 86,693,988 (GRCm39) missense probably damaging 1.00
R4088:Stab2 UTSW 10 86,758,049 (GRCm39) missense probably damaging 1.00
R4151:Stab2 UTSW 10 86,838,847 (GRCm39) missense probably benign 0.12
R4190:Stab2 UTSW 10 86,714,808 (GRCm39) missense probably damaging 0.98
R4556:Stab2 UTSW 10 86,803,543 (GRCm39) missense possibly damaging 0.95
R4773:Stab2 UTSW 10 86,743,235 (GRCm39) nonsense probably null
R4825:Stab2 UTSW 10 86,783,011 (GRCm39) missense probably benign 0.08
R4865:Stab2 UTSW 10 86,679,364 (GRCm39) splice site probably null
R4871:Stab2 UTSW 10 86,778,099 (GRCm39) missense probably damaging 0.99
R4943:Stab2 UTSW 10 86,790,026 (GRCm39) missense probably damaging 0.99
R4981:Stab2 UTSW 10 86,796,087 (GRCm39) missense probably benign
R4994:Stab2 UTSW 10 86,785,771 (GRCm39) missense probably benign
R4999:Stab2 UTSW 10 86,773,773 (GRCm39) missense probably damaging 0.97
R5061:Stab2 UTSW 10 86,743,249 (GRCm39) missense probably damaging 1.00
R5072:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5073:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5074:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5134:Stab2 UTSW 10 86,707,674 (GRCm39) splice site probably null
R5213:Stab2 UTSW 10 86,743,061 (GRCm39) missense probably damaging 0.99
R5508:Stab2 UTSW 10 86,796,143 (GRCm39) missense probably benign 0.01
R5530:Stab2 UTSW 10 86,783,026 (GRCm39) missense probably benign 0.04
R5540:Stab2 UTSW 10 86,683,989 (GRCm39) missense probably benign 0.30
R5839:Stab2 UTSW 10 86,708,555 (GRCm39) missense probably damaging 0.97
R5949:Stab2 UTSW 10 86,805,713 (GRCm39) missense possibly damaging 0.87
R6015:Stab2 UTSW 10 86,773,906 (GRCm39) missense probably damaging 0.99
R6019:Stab2 UTSW 10 86,838,886 (GRCm39) missense probably benign 0.00
R6116:Stab2 UTSW 10 86,743,054 (GRCm39) missense probably damaging 1.00
R6131:Stab2 UTSW 10 86,719,642 (GRCm39) splice site probably null
R6209:Stab2 UTSW 10 86,758,867 (GRCm39) missense possibly damaging 0.94
R6243:Stab2 UTSW 10 86,743,025 (GRCm39) missense probably damaging 1.00
R6433:Stab2 UTSW 10 86,737,431 (GRCm39) splice site probably null
R6841:Stab2 UTSW 10 86,778,054 (GRCm39) missense probably damaging 1.00
R6873:Stab2 UTSW 10 86,697,230 (GRCm39) critical splice donor site probably null
R7025:Stab2 UTSW 10 86,686,701 (GRCm39) missense probably damaging 1.00
R7043:Stab2 UTSW 10 86,706,110 (GRCm39) missense probably damaging 0.99
R7047:Stab2 UTSW 10 86,694,016 (GRCm39) missense probably damaging 1.00
R7107:Stab2 UTSW 10 86,741,456 (GRCm39) missense possibly damaging 0.96
R7214:Stab2 UTSW 10 86,735,705 (GRCm39) missense probably damaging 0.99
R7271:Stab2 UTSW 10 86,838,972 (GRCm39) splice site probably null
R7291:Stab2 UTSW 10 86,782,084 (GRCm39) missense probably damaging 0.96
R7336:Stab2 UTSW 10 86,805,049 (GRCm39) nonsense probably null
R7432:Stab2 UTSW 10 86,721,547 (GRCm39) missense probably damaging 0.99
R7580:Stab2 UTSW 10 86,705,028 (GRCm39) missense probably benign 0.00
R7622:Stab2 UTSW 10 86,709,766 (GRCm39) missense possibly damaging 0.65
R7629:Stab2 UTSW 10 86,719,646 (GRCm39) critical splice donor site probably null
R7658:Stab2 UTSW 10 86,816,999 (GRCm39) missense probably benign 0.12
R7798:Stab2 UTSW 10 86,793,776 (GRCm39) missense probably damaging 0.98
R7835:Stab2 UTSW 10 86,708,483 (GRCm39) missense probably benign 0.06
R7845:Stab2 UTSW 10 86,832,758 (GRCm39) missense probably benign 0.09
R7863:Stab2 UTSW 10 86,808,745 (GRCm39) missense probably benign 0.30
R7885:Stab2 UTSW 10 86,714,776 (GRCm39) missense probably benign 0.03
R7904:Stab2 UTSW 10 86,790,056 (GRCm39) nonsense probably null
R7947:Stab2 UTSW 10 86,681,897 (GRCm39) missense probably benign 0.31
R7963:Stab2 UTSW 10 86,683,887 (GRCm39) critical splice donor site probably null
R8014:Stab2 UTSW 10 86,686,767 (GRCm39) missense possibly damaging 0.78
R8021:Stab2 UTSW 10 86,741,403 (GRCm39) missense possibly damaging 0.69
R8024:Stab2 UTSW 10 86,681,916 (GRCm39) missense probably benign 0.34
R8097:Stab2 UTSW 10 86,704,959 (GRCm39) missense possibly damaging 0.86
R8281:Stab2 UTSW 10 86,709,728 (GRCm39) missense probably damaging 0.98
R8462:Stab2 UTSW 10 86,803,598 (GRCm39) missense possibly damaging 0.79
R8670:Stab2 UTSW 10 86,776,587 (GRCm39) missense probably damaging 1.00
R8692:Stab2 UTSW 10 86,808,794 (GRCm39) missense probably damaging 0.99
R8744:Stab2 UTSW 10 86,805,213 (GRCm39) missense probably benign 0.32
R8745:Stab2 UTSW 10 86,805,213 (GRCm39) missense probably benign 0.32
R8782:Stab2 UTSW 10 86,735,685 (GRCm39) missense probably benign 0.00
R8875:Stab2 UTSW 10 86,832,728 (GRCm39) missense probably damaging 1.00
R8978:Stab2 UTSW 10 86,785,782 (GRCm39) missense possibly damaging 0.64
R9141:Stab2 UTSW 10 86,704,911 (GRCm39) missense probably damaging 1.00
R9248:Stab2 UTSW 10 86,727,481 (GRCm39) missense probably damaging 0.98
R9326:Stab2 UTSW 10 86,791,010 (GRCm39) missense probably damaging 1.00
R9426:Stab2 UTSW 10 86,704,911 (GRCm39) missense probably damaging 1.00
R9568:Stab2 UTSW 10 86,699,420 (GRCm39) missense probably damaging 1.00
R9627:Stab2 UTSW 10 86,793,704 (GRCm39) missense probably damaging 0.98
R9635:Stab2 UTSW 10 86,686,651 (GRCm39) nonsense probably null
R9648:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9649:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9650:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9726:Stab2 UTSW 10 86,790,095 (GRCm39) missense probably benign 0.00
R9756:Stab2 UTSW 10 86,803,553 (GRCm39) missense possibly damaging 0.50
R9786:Stab2 UTSW 10 86,757,997 (GRCm39) missense probably benign 0.03
RF061:Stab2 UTSW 10 86,702,622 (GRCm39) critical splice acceptor site probably benign
X0023:Stab2 UTSW 10 86,758,062 (GRCm39) critical splice acceptor site probably null
X0025:Stab2 UTSW 10 86,723,680 (GRCm39) missense probably damaging 1.00
Z1176:Stab2 UTSW 10 86,785,778 (GRCm39) missense probably damaging 0.99
Z1177:Stab2 UTSW 10 86,732,460 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCCTTCGATAAGTACTAAGGC -3'
(R):5'- GACTTGACAATCAGAGTACATCAC -3'

Sequencing Primer
(F):5'- TCTGCCTATTGGGTAAGG -3'
(R):5'- GAAAGCCATCTTCTCATTTGGG -3'
Posted On 2018-08-29