Incidental Mutation 'R6787:Cpeb3'
ID532457
Institutional Source Beutler Lab
Gene Symbol Cpeb3
Ensembl Gene ENSMUSG00000039652
Gene Namecytoplasmic polyadenylation element binding protein 3
Synonyms4831444O18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.395) question?
Stock #R6787 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location37021291-37208601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37044689 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 569 (I569V)
Ref Sequence ENSEMBL: ENSMUSP00000116309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079754] [ENSMUST00000123727] [ENSMUST00000124158] [ENSMUST00000126188] [ENSMUST00000132580] [ENSMUST00000136286] [ENSMUST00000154376]
Predicted Effect probably benign
Transcript: ENSMUST00000079754
AA Change: I586V

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000078690
Gene: ENSMUSG00000039652
AA Change: I586V

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 410 420 N/A INTRINSIC
RRM 460 532 2.01e-5 SMART
RRM 568 641 1e-2 SMART
PDB:2M13|A 642 707 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000123727
AA Change: I555V

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121987
Gene: ENSMUSG00000039652
AA Change: I555V

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
RRM 429 501 2.01e-5 SMART
RRM 537 610 1e-2 SMART
PDB:2M13|A 611 676 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000124158
AA Change: I285V

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115656
Gene: ENSMUSG00000039652
AA Change: I285V

DomainStartEndE-ValueType
RRM 159 231 2.01e-5 SMART
RRM 267 340 1e-2 SMART
PDB:2M13|A 341 406 6e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000126188
AA Change: I563V

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120416
Gene: ENSMUSG00000039652
AA Change: I563V

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
RRM 437 509 2.01e-5 SMART
RRM 545 618 1e-2 SMART
PDB:2M13|A 619 684 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000132580
AA Change: I586V

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118723
Gene: ENSMUSG00000039652
AA Change: I586V

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 410 420 N/A INTRINSIC
RRM 460 532 2.01e-5 SMART
RRM 568 641 1e-2 SMART
PDB:2M13|A 642 707 1e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000136286
AA Change: I569V

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116309
Gene: ENSMUSG00000039652
AA Change: I569V

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
RRM 443 515 2.01e-5 SMART
RRM 551 624 1e-2 SMART
PDB:2M13|A 625 690 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154376
AA Change: I586V

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116172
Gene: ENSMUSG00000039652
AA Change: I586V

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 410 420 N/A INTRINSIC
RRM 460 532 2.01e-5 SMART
RRM 568 641 1e-2 SMART
PDB:2M13|A 642 707 1e-6 PDB
Meta Mutation Damage Score 0.1198 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 96% (51/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, increased anxiety-related response, enhanced contextual conditioning behavior, abnormal spatial reference memory, hypoactivity and abnormal hippocampus pyramidal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik G A 12: 55,079,983 T32I probably benign Het
4930486L24Rik T A 13: 60,853,108 I205L probably benign Het
Aatk C T 11: 120,010,682 V963M probably damaging Het
Adra1b C A 11: 43,835,415 R225L probably damaging Het
Adrb1 T C 19: 56,722,589 V73A probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
BC035947 G T 1: 78,498,890 P335Q possibly damaging Het
C2cd3 T C 7: 100,455,346 F2189L probably benign Het
Capn9 A G 8: 124,616,185 I635V probably benign Het
Cep55 T A 19: 38,057,926 D42E probably benign Het
Cftr T A 6: 18,274,608 Y878* probably null Het
Clpb A T 7: 101,663,659 probably benign Het
Cpne6 A T 14: 55,515,244 D297V probably damaging Het
Ddhd1 T C 14: 45,657,519 T165A probably benign Het
Fam98b T C 2: 117,262,921 probably null Het
Frem2 T C 3: 53,654,323 N921S probably benign Het
Gbf1 T A 19: 46,271,772 V1039E probably benign Het
Gmip A G 8: 69,813,786 E212G probably damaging Het
Gpcpd1 C T 2: 132,537,838 probably benign Het
Gtf2ird1 A T 5: 134,363,912 N796K probably damaging Het
Hadhb T C 5: 30,155,249 probably benign Het
Itga4 T A 2: 79,289,265 S472T probably damaging Het
Kcna4 G A 2: 107,295,325 E135K possibly damaging Het
Kmt2c G T 5: 25,275,739 probably null Het
Lama1 T C 17: 67,784,025 I1620T unknown Het
Lins1 A G 7: 66,714,154 E594G probably benign Het
Lrrc38 T A 4: 143,369,794 M225K probably benign Het
Mphosph9 A G 5: 124,261,027 I975T probably damaging Het
Mrgprh T C 17: 12,876,987 F38S probably benign Het
Myo1h G A 5: 114,320,653 G150R probably damaging Het
Oas2 T G 5: 120,738,798 I391L possibly damaging Het
Olfr1242 T A 2: 89,494,034 R93* probably null Het
Olfr18 T C 9: 20,335,925 D14G probably benign Het
Olfr497 T C 7: 108,422,682 I37T possibly damaging Het
Olfr803 T A 10: 129,691,522 D173V possibly damaging Het
Pdcd5 T C 7: 35,642,638 T182A probably damaging Het
Pdlim7 T C 13: 55,508,997 D48G probably damaging Het
Polr3b A C 10: 84,628,625 probably null Het
Psmd5 C T 2: 34,857,637 probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Sdhb T C 4: 140,976,190 Y208H probably damaging Het
Serinc5 G A 13: 92,706,232 V397I possibly damaging Het
Sik2 A T 9: 50,998,534 M73K possibly damaging Het
Slc41a1 A G 1: 131,842,749 probably null Het
Slco1a1 T C 6: 141,936,487 I119V probably benign Het
Srd5a1 T C 13: 69,611,299 probably benign Het
Stab2 T C 10: 86,919,084 I1111V probably benign Het
Stxbp6 G T 12: 44,902,996 probably null Het
Tbc1d19 A G 5: 53,835,249 probably null Het
Tnxb A T 17: 34,710,736 T2815S probably benign Het
Txnip T A 3: 96,560,307 I363N probably damaging Het
Zfp442 A T 2: 150,409,579 N134K possibly damaging Het
Other mutations in Cpeb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Cpeb3 APN 19 37054295 missense probably damaging 1.00
IGL01402:Cpeb3 APN 19 37088548 missense probably benign 0.01
IGL01404:Cpeb3 APN 19 37088548 missense probably benign 0.01
IGL01702:Cpeb3 APN 19 37126382 missense possibly damaging 0.85
IGL01811:Cpeb3 APN 19 37044608 missense probably damaging 1.00
IGL03036:Cpeb3 APN 19 37024948 missense probably damaging 1.00
R0580:Cpeb3 UTSW 19 37174035 missense probably benign 0.02
R1463:Cpeb3 UTSW 19 37139100 missense probably benign 0.08
R1572:Cpeb3 UTSW 19 37139082 missense probably benign 0.38
R1914:Cpeb3 UTSW 19 37054265 missense probably damaging 1.00
R1915:Cpeb3 UTSW 19 37054265 missense probably damaging 1.00
R2031:Cpeb3 UTSW 19 37044679 missense probably damaging 1.00
R4296:Cpeb3 UTSW 19 37173989 missense possibly damaging 0.90
R4528:Cpeb3 UTSW 19 37139088 missense possibly damaging 0.85
R4607:Cpeb3 UTSW 19 37174839 missense possibly damaging 0.82
R4909:Cpeb3 UTSW 19 37174659 missense probably damaging 1.00
R4909:Cpeb3 UTSW 19 37174233 missense possibly damaging 0.63
R5240:Cpeb3 UTSW 19 37174515 missense probably damaging 0.99
R5985:Cpeb3 UTSW 19 37087552 missense probably damaging 1.00
R6179:Cpeb3 UTSW 19 37088453 missense probably damaging 1.00
R6309:Cpeb3 UTSW 19 37044689 missense possibly damaging 0.87
R6768:Cpeb3 UTSW 19 37025032 missense possibly damaging 0.92
R7102:Cpeb3 UTSW 19 37174719 missense probably benign
R7194:Cpeb3 UTSW 19 37174752 missense probably benign
R7422:Cpeb3 UTSW 19 37174500 missense probably benign 0.13
R7594:Cpeb3 UTSW 19 37174151 missense possibly damaging 0.70
R7630:Cpeb3 UTSW 19 37054293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATACTGTCTGGCCCAGG -3'
(R):5'- CAATGAGTGGCTCTTCGATCAG -3'

Sequencing Primer
(F):5'- GGGCTGCACAAATAAACTTCATTTCC -3'
(R):5'- GCTCTTCGATCAGAATTGGAAGAC -3'
Posted On2018-08-29