Incidental Mutation 'R6788:Uggt1'
ID 532461
Institutional Source Beutler Lab
Gene Symbol Uggt1
Ensembl Gene ENSMUSG00000037470
Gene Name UDP-glucose glycoprotein glucosyltransferase 1
Synonyms C820010P03Rik, 0910001L17Rik, Ugcgl1, A930007H10Rik
MMRRC Submission 044902-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.470) question?
Stock # R6788 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 36179109-36283407 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 36269769 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 83 (T83S)
Ref Sequence ENSEMBL: ENSMUSP00000134640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046875] [ENSMUST00000174266]
AlphaFold Q6P5E4
Predicted Effect probably benign
Transcript: ENSMUST00000046875
AA Change: T83S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037930
Gene: ENSMUSG00000037470
AA Change: T83S

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:UDP-g_GGTase 44 1222 N/A PFAM
SCOP:d1ga8a_ 1256 1521 3e-45 SMART
Blast:BROMO 1414 1453 3e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174266
AA Change: T83S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134640
Gene: ENSMUSG00000037470
AA Change: T83S

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.4%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
PHENOTYPE: Heterozygous KO reduces susceptibility to and morbidity of RNA virus infection. Homozygous KO is embryonic lethal. The peptide is a folding sensor for glycoproteins in the ER. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A T 1: 179,580,199 (GRCm39) V2001E probably benign Het
Ahsg A G 16: 22,713,585 (GRCm39) D122G probably benign Het
Ank3 A G 10: 69,840,553 (GRCm39) Y1616C probably damaging Het
Arhgef1 A G 7: 24,619,205 (GRCm39) probably null Het
Atp7b T C 8: 22,494,391 (GRCm39) I1023V probably benign Het
Bod1l A T 5: 41,979,216 (GRCm39) Y699* probably null Het
Car12 C T 9: 66,659,244 (GRCm39) S183L probably damaging Het
Cep290 T C 10: 100,324,490 (GRCm39) S57P probably damaging Het
Cep57l1 T C 10: 41,619,145 (GRCm39) D74G probably damaging Het
Cers6 T C 2: 68,938,903 (GRCm39) Y374H possibly damaging Het
Chmp4c T A 3: 10,432,195 (GRCm39) M35K possibly damaging Het
Crkl G A 16: 17,301,645 (GRCm39) D300N probably damaging Het
Cyp3a41a A G 5: 145,642,639 (GRCm39) M240T probably benign Het
Dipk2a C T 9: 94,406,502 (GRCm39) V302I probably benign Het
Dnah12 G T 14: 26,523,470 (GRCm39) L1986F probably damaging Het
Dnah8 T C 17: 30,867,439 (GRCm39) I297T probably benign Het
Dock10 T A 1: 80,508,962 (GRCm39) I1610F probably damaging Het
Dpys T A 15: 39,720,559 (GRCm39) H67L probably damaging Het
Epc2 T G 2: 49,422,099 (GRCm39) V331G probably benign Het
Fnbp1l G A 3: 122,339,956 (GRCm39) R344* probably null Het
Gmip G T 8: 70,263,824 (GRCm39) L89F possibly damaging Het
Gmip G C 8: 70,263,826 (GRCm39) R90P probably damaging Het
Gpi1 A G 7: 33,928,415 (GRCm39) S74P probably damaging Het
Gys1 G A 7: 45,094,102 (GRCm39) E406K probably damaging Het
Hspg2 G A 4: 137,242,618 (GRCm39) G611E probably damaging Het
Klhl29 C T 12: 5,134,393 (GRCm39) V673M probably damaging Het
Lnpk T C 2: 74,360,020 (GRCm39) T332A probably benign Het
Loxl4 T C 19: 42,596,792 (GRCm39) D60G probably damaging Het
Lrr1 T C 12: 69,221,449 (GRCm39) I197T probably damaging Het
Map1lc3b A G 8: 122,320,316 (GRCm39) N43S probably benign Het
Map3k21 A T 8: 126,666,605 (GRCm39) D599V probably benign Het
Mastl T C 2: 23,023,710 (GRCm39) N338D probably benign Het
Mepe A T 5: 104,486,074 (GRCm39) R405* probably null Het
Mrps30 T C 13: 118,516,908 (GRCm39) E437G probably benign Het
Mup15 A G 4: 61,356,465 (GRCm39) V100A possibly damaging Het
Olfml1 A T 7: 107,167,075 (GRCm39) I35F probably damaging Het
Olfml2a T A 2: 38,850,238 (GRCm39) Y651* probably null Het
Or2h1b T A 17: 37,462,713 (GRCm39) D50V probably damaging Het
Otog T C 7: 45,947,741 (GRCm39) V113A probably damaging Het
Parvg C T 15: 84,210,464 (GRCm39) L44F possibly damaging Het
Pcnx2 G T 8: 126,498,839 (GRCm39) D1553E probably damaging Het
Pcyt2 C T 11: 120,505,200 (GRCm39) G122S probably damaging Het
Pi4ka A G 16: 17,194,846 (GRCm39) L184P possibly damaging Het
Polq C T 16: 36,897,510 (GRCm39) T2134I probably damaging Het
Prkce T G 17: 86,937,489 (GRCm39) F641V probably damaging Het
Prss1 T C 6: 41,440,654 (GRCm39) I243T possibly damaging Het
Pxmp2 A G 5: 110,429,185 (GRCm39) F91L probably benign Het
Ralgapb G A 2: 158,278,486 (GRCm39) G5R probably damaging Het
Rasgef1a T G 6: 118,064,174 (GRCm39) M337R possibly damaging Het
Rassf2 A G 2: 131,844,845 (GRCm39) M199T probably damaging Het
Rtbdn A T 8: 85,679,303 (GRCm39) Y67F probably null Het
Scamp3 T C 3: 89,089,256 (GRCm39) V271A probably benign Het
Sema3a A T 5: 13,647,584 (GRCm39) R613W possibly damaging Het
Slc4a3 A T 1: 75,527,959 (GRCm39) I206F probably damaging Het
Slc9b1 A G 3: 135,063,518 (GRCm39) probably null Het
Smchd1 C A 17: 71,782,096 (GRCm39) V22F probably benign Het
Smg1 A G 7: 117,783,794 (GRCm39) probably benign Het
Spaca7b T C 8: 11,728,584 (GRCm39) E29G possibly damaging Het
Spata31e4 A C 13: 50,857,131 (GRCm39) H923P probably damaging Het
Stab1 A G 14: 30,861,117 (GRCm39) L89P probably damaging Het
Stim1 A G 7: 102,076,498 (GRCm39) E152G probably damaging Het
Tenm3 A G 8: 49,127,528 (GRCm39) F50S probably damaging Het
Tpgs2 T G 18: 25,262,927 (GRCm39) N231H probably benign Het
Trank1 T A 9: 111,219,747 (GRCm39) N2161K probably damaging Het
Trim28 A G 7: 12,759,273 (GRCm39) D129G probably benign Het
Trim66 A T 7: 109,076,961 (GRCm39) I326N probably damaging Het
Trim80 A T 11: 115,338,843 (GRCm39) T558S probably benign Het
Wdr91 A G 6: 34,863,754 (GRCm39) I587T probably damaging Het
Zpld1 A T 16: 55,052,603 (GRCm39) V337D possibly damaging Het
Other mutations in Uggt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Uggt1 APN 1 36,218,633 (GRCm39) splice site probably benign
IGL00817:Uggt1 APN 1 36,225,013 (GRCm39) missense probably benign 0.03
IGL01395:Uggt1 APN 1 36,194,158 (GRCm39) missense probably damaging 1.00
IGL01609:Uggt1 APN 1 36,221,555 (GRCm39) missense probably damaging 1.00
IGL01619:Uggt1 APN 1 36,200,775 (GRCm39) missense probably damaging 0.99
IGL02077:Uggt1 APN 1 36,215,875 (GRCm39) missense probably damaging 0.99
IGL02313:Uggt1 APN 1 36,223,565 (GRCm39) missense probably damaging 0.99
IGL02341:Uggt1 APN 1 36,203,600 (GRCm39) makesense probably null
IGL02346:Uggt1 APN 1 36,218,751 (GRCm39) missense probably benign 0.00
IGL02447:Uggt1 APN 1 36,189,223 (GRCm39) missense probably damaging 1.00
IGL02883:Uggt1 APN 1 36,216,696 (GRCm39) missense probably benign 0.03
IGL02930:Uggt1 APN 1 36,196,537 (GRCm39) missense probably benign 0.01
IGL03153:Uggt1 APN 1 36,241,899 (GRCm39) missense possibly damaging 0.94
IGL03162:Uggt1 APN 1 36,247,037 (GRCm39) missense probably damaging 1.00
IGL03170:Uggt1 APN 1 36,202,342 (GRCm39) missense probably damaging 1.00
IGL03266:Uggt1 APN 1 36,189,129 (GRCm39) missense probably damaging 1.00
K3955:Uggt1 UTSW 1 36,201,434 (GRCm39) missense probably benign 0.37
R0037:Uggt1 UTSW 1 36,225,013 (GRCm39) missense probably benign 0.03
R0037:Uggt1 UTSW 1 36,225,013 (GRCm39) missense probably benign 0.03
R0167:Uggt1 UTSW 1 36,209,278 (GRCm39) critical splice donor site probably null
R0373:Uggt1 UTSW 1 36,218,751 (GRCm39) missense probably benign 0.00
R0502:Uggt1 UTSW 1 36,199,027 (GRCm39) missense probably damaging 1.00
R0546:Uggt1 UTSW 1 36,235,052 (GRCm39) missense probably benign 0.00
R0610:Uggt1 UTSW 1 36,204,587 (GRCm39) splice site probably benign
R0671:Uggt1 UTSW 1 36,194,209 (GRCm39) missense probably damaging 1.00
R0760:Uggt1 UTSW 1 36,200,805 (GRCm39) missense possibly damaging 0.68
R0825:Uggt1 UTSW 1 36,197,224 (GRCm39) missense probably benign 0.01
R0827:Uggt1 UTSW 1 36,195,394 (GRCm39) critical splice acceptor site probably null
R0884:Uggt1 UTSW 1 36,214,159 (GRCm39) missense probably benign 0.00
R1112:Uggt1 UTSW 1 36,212,627 (GRCm39) missense possibly damaging 0.54
R1470:Uggt1 UTSW 1 36,215,877 (GRCm39) missense probably benign 0.13
R1470:Uggt1 UTSW 1 36,215,877 (GRCm39) missense probably benign 0.13
R1592:Uggt1 UTSW 1 36,241,939 (GRCm39) missense probably benign 0.04
R1730:Uggt1 UTSW 1 36,260,342 (GRCm39) missense probably benign 0.05
R1923:Uggt1 UTSW 1 36,218,694 (GRCm39) missense probably damaging 0.99
R1970:Uggt1 UTSW 1 36,190,862 (GRCm39) missense probably damaging 1.00
R2086:Uggt1 UTSW 1 36,231,495 (GRCm39) missense probably null 1.00
R2829:Uggt1 UTSW 1 36,201,375 (GRCm39) missense probably benign 0.38
R3431:Uggt1 UTSW 1 36,249,140 (GRCm39) nonsense probably null
R3432:Uggt1 UTSW 1 36,249,140 (GRCm39) nonsense probably null
R3725:Uggt1 UTSW 1 36,221,588 (GRCm39) nonsense probably null
R3880:Uggt1 UTSW 1 36,215,885 (GRCm39) intron probably benign
R4052:Uggt1 UTSW 1 36,203,570 (GRCm39) missense probably damaging 0.98
R4133:Uggt1 UTSW 1 36,197,240 (GRCm39) missense probably damaging 1.00
R4489:Uggt1 UTSW 1 36,185,749 (GRCm39) nonsense probably null
R4570:Uggt1 UTSW 1 36,189,154 (GRCm39) missense probably damaging 1.00
R4866:Uggt1 UTSW 1 36,241,936 (GRCm39) nonsense probably null
R4895:Uggt1 UTSW 1 36,195,345 (GRCm39) missense probably damaging 1.00
R4900:Uggt1 UTSW 1 36,241,936 (GRCm39) nonsense probably null
R5372:Uggt1 UTSW 1 36,283,141 (GRCm39) splice site probably benign
R5385:Uggt1 UTSW 1 36,223,493 (GRCm39) missense probably damaging 1.00
R5652:Uggt1 UTSW 1 36,255,234 (GRCm39) nonsense probably null
R5694:Uggt1 UTSW 1 36,218,737 (GRCm39) missense probably damaging 1.00
R5732:Uggt1 UTSW 1 36,200,852 (GRCm39) splice site probably null
R5893:Uggt1 UTSW 1 36,266,709 (GRCm39) splice site probably null
R6191:Uggt1 UTSW 1 36,201,289 (GRCm39) missense probably damaging 0.98
R6247:Uggt1 UTSW 1 36,202,309 (GRCm39) missense probably damaging 1.00
R6259:Uggt1 UTSW 1 36,273,997 (GRCm39) missense probably benign 0.00
R6399:Uggt1 UTSW 1 36,202,447 (GRCm39) missense possibly damaging 0.90
R6439:Uggt1 UTSW 1 36,214,032 (GRCm39) missense possibly damaging 0.95
R6468:Uggt1 UTSW 1 36,212,531 (GRCm39) missense probably benign 0.00
R7165:Uggt1 UTSW 1 36,194,188 (GRCm39) missense probably benign 0.41
R7255:Uggt1 UTSW 1 36,185,187 (GRCm39) missense probably damaging 1.00
R7273:Uggt1 UTSW 1 36,201,302 (GRCm39) missense probably damaging 0.99
R7469:Uggt1 UTSW 1 36,190,814 (GRCm39) missense probably damaging 1.00
R7490:Uggt1 UTSW 1 36,203,589 (GRCm39) missense probably benign 0.01
R7570:Uggt1 UTSW 1 36,224,919 (GRCm39) missense probably benign 0.09
R7612:Uggt1 UTSW 1 36,202,316 (GRCm39) missense probably damaging 0.99
R7759:Uggt1 UTSW 1 36,185,806 (GRCm39) missense possibly damaging 0.81
R7792:Uggt1 UTSW 1 36,247,065 (GRCm39) missense probably damaging 1.00
R7816:Uggt1 UTSW 1 36,202,396 (GRCm39) missense possibly damaging 0.95
R7858:Uggt1 UTSW 1 36,195,339 (GRCm39) missense probably damaging 1.00
R7887:Uggt1 UTSW 1 36,247,115 (GRCm39) missense probably damaging 0.99
R8040:Uggt1 UTSW 1 36,250,554 (GRCm39) missense possibly damaging 0.70
R8093:Uggt1 UTSW 1 36,266,566 (GRCm39) missense probably damaging 1.00
R8245:Uggt1 UTSW 1 36,204,645 (GRCm39) missense probably damaging 1.00
R8338:Uggt1 UTSW 1 36,266,602 (GRCm39) missense probably damaging 1.00
R8353:Uggt1 UTSW 1 36,209,377 (GRCm39) critical splice acceptor site probably null
R8442:Uggt1 UTSW 1 36,212,568 (GRCm39) missense probably damaging 0.99
R8519:Uggt1 UTSW 1 36,215,724 (GRCm39) splice site probably null
R8529:Uggt1 UTSW 1 36,223,513 (GRCm39) missense possibly damaging 0.85
R8730:Uggt1 UTSW 1 36,236,624 (GRCm39) critical splice donor site probably null
R8917:Uggt1 UTSW 1 36,185,735 (GRCm39) missense
R8947:Uggt1 UTSW 1 36,197,229 (GRCm39) missense probably benign 0.12
R9240:Uggt1 UTSW 1 36,221,696 (GRCm39) missense possibly damaging 0.50
R9248:Uggt1 UTSW 1 36,249,103 (GRCm39) missense possibly damaging 0.80
R9401:Uggt1 UTSW 1 36,255,212 (GRCm39) critical splice donor site probably null
R9414:Uggt1 UTSW 1 36,223,507 (GRCm39) missense probably benign 0.01
R9416:Uggt1 UTSW 1 36,203,603 (GRCm39) missense
R9441:Uggt1 UTSW 1 36,260,306 (GRCm39) missense probably benign 0.02
R9489:Uggt1 UTSW 1 36,273,886 (GRCm39) critical splice donor site probably null
R9563:Uggt1 UTSW 1 36,204,627 (GRCm39) missense possibly damaging 0.60
R9605:Uggt1 UTSW 1 36,273,886 (GRCm39) critical splice donor site probably null
X0022:Uggt1 UTSW 1 36,204,636 (GRCm39) missense possibly damaging 0.67
Z1088:Uggt1 UTSW 1 36,213,272 (GRCm39) missense probably damaging 1.00
Z1176:Uggt1 UTSW 1 36,200,776 (GRCm39) missense probably damaging 1.00
Z1177:Uggt1 UTSW 1 36,194,154 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCCTACCATGGCAACTGTCG -3'
(R):5'- CATTTGTACATTAGGGCTTCCC -3'

Sequencing Primer
(F):5'- CATGGCAACTGTCGTCATTAACG -3'
(R):5'- GCTACTGAGTGAACACATTATTATGC -3'
Posted On 2018-08-29