Incidental Mutation 'R6788:Mastl'
ID 532465
Institutional Source Beutler Lab
Gene Symbol Mastl
Ensembl Gene ENSMUSG00000026779
Gene Name microtubule associated serine/threonine kinase-like
Synonyms THC2, 2700091H24Rik
MMRRC Submission 044902-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6788 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 23006549-23046036 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23023710 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 338 (N338D)
Ref Sequence ENSEMBL: ENSMUSP00000028119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028119]
AlphaFold Q8C0P0
Predicted Effect probably benign
Transcript: ENSMUST00000028119
AA Change: N338D

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028119
Gene: ENSMUSG00000026779
AA Change: N338D

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Pkinase_Tyr 34 194 2.6e-24 PFAM
Pfam:Pkinase 34 200 2.3e-39 PFAM
low complexity region 297 313 N/A INTRINSIC
Pfam:Pkinase 710 821 6.4e-19 PFAM
Pfam:Pkinase_Tyr 714 818 5.1e-6 PFAM
S_TK_X 822 864 2.01e-1 SMART
Meta Mutation Damage Score 0.2514 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.4%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated serine/threonine kinase. Mutations at this locus have been associated with autosomal dominant thrombocytopenia, also known as thrombocytopenia-2. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality and mitotic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A T 1: 179,580,199 (GRCm39) V2001E probably benign Het
Ahsg A G 16: 22,713,585 (GRCm39) D122G probably benign Het
Ank3 A G 10: 69,840,553 (GRCm39) Y1616C probably damaging Het
Arhgef1 A G 7: 24,619,205 (GRCm39) probably null Het
Atp7b T C 8: 22,494,391 (GRCm39) I1023V probably benign Het
Bod1l A T 5: 41,979,216 (GRCm39) Y699* probably null Het
Car12 C T 9: 66,659,244 (GRCm39) S183L probably damaging Het
Cep290 T C 10: 100,324,490 (GRCm39) S57P probably damaging Het
Cep57l1 T C 10: 41,619,145 (GRCm39) D74G probably damaging Het
Cers6 T C 2: 68,938,903 (GRCm39) Y374H possibly damaging Het
Chmp4c T A 3: 10,432,195 (GRCm39) M35K possibly damaging Het
Crkl G A 16: 17,301,645 (GRCm39) D300N probably damaging Het
Cyp3a41a A G 5: 145,642,639 (GRCm39) M240T probably benign Het
Dipk2a C T 9: 94,406,502 (GRCm39) V302I probably benign Het
Dnah12 G T 14: 26,523,470 (GRCm39) L1986F probably damaging Het
Dnah8 T C 17: 30,867,439 (GRCm39) I297T probably benign Het
Dock10 T A 1: 80,508,962 (GRCm39) I1610F probably damaging Het
Dpys T A 15: 39,720,559 (GRCm39) H67L probably damaging Het
Epc2 T G 2: 49,422,099 (GRCm39) V331G probably benign Het
Fnbp1l G A 3: 122,339,956 (GRCm39) R344* probably null Het
Gmip G T 8: 70,263,824 (GRCm39) L89F possibly damaging Het
Gmip G C 8: 70,263,826 (GRCm39) R90P probably damaging Het
Gpi1 A G 7: 33,928,415 (GRCm39) S74P probably damaging Het
Gys1 G A 7: 45,094,102 (GRCm39) E406K probably damaging Het
Hspg2 G A 4: 137,242,618 (GRCm39) G611E probably damaging Het
Klhl29 C T 12: 5,134,393 (GRCm39) V673M probably damaging Het
Lnpk T C 2: 74,360,020 (GRCm39) T332A probably benign Het
Loxl4 T C 19: 42,596,792 (GRCm39) D60G probably damaging Het
Lrr1 T C 12: 69,221,449 (GRCm39) I197T probably damaging Het
Map1lc3b A G 8: 122,320,316 (GRCm39) N43S probably benign Het
Map3k21 A T 8: 126,666,605 (GRCm39) D599V probably benign Het
Mepe A T 5: 104,486,074 (GRCm39) R405* probably null Het
Mrps30 T C 13: 118,516,908 (GRCm39) E437G probably benign Het
Mup15 A G 4: 61,356,465 (GRCm39) V100A possibly damaging Het
Olfml1 A T 7: 107,167,075 (GRCm39) I35F probably damaging Het
Olfml2a T A 2: 38,850,238 (GRCm39) Y651* probably null Het
Or2h1b T A 17: 37,462,713 (GRCm39) D50V probably damaging Het
Otog T C 7: 45,947,741 (GRCm39) V113A probably damaging Het
Parvg C T 15: 84,210,464 (GRCm39) L44F possibly damaging Het
Pcnx2 G T 8: 126,498,839 (GRCm39) D1553E probably damaging Het
Pcyt2 C T 11: 120,505,200 (GRCm39) G122S probably damaging Het
Pi4ka A G 16: 17,194,846 (GRCm39) L184P possibly damaging Het
Polq C T 16: 36,897,510 (GRCm39) T2134I probably damaging Het
Prkce T G 17: 86,937,489 (GRCm39) F641V probably damaging Het
Prss1 T C 6: 41,440,654 (GRCm39) I243T possibly damaging Het
Pxmp2 A G 5: 110,429,185 (GRCm39) F91L probably benign Het
Ralgapb G A 2: 158,278,486 (GRCm39) G5R probably damaging Het
Rasgef1a T G 6: 118,064,174 (GRCm39) M337R possibly damaging Het
Rassf2 A G 2: 131,844,845 (GRCm39) M199T probably damaging Het
Rtbdn A T 8: 85,679,303 (GRCm39) Y67F probably null Het
Scamp3 T C 3: 89,089,256 (GRCm39) V271A probably benign Het
Sema3a A T 5: 13,647,584 (GRCm39) R613W possibly damaging Het
Slc4a3 A T 1: 75,527,959 (GRCm39) I206F probably damaging Het
Slc9b1 A G 3: 135,063,518 (GRCm39) probably null Het
Smchd1 C A 17: 71,782,096 (GRCm39) V22F probably benign Het
Smg1 A G 7: 117,783,794 (GRCm39) probably benign Het
Spaca7b T C 8: 11,728,584 (GRCm39) E29G possibly damaging Het
Spata31e4 A C 13: 50,857,131 (GRCm39) H923P probably damaging Het
Stab1 A G 14: 30,861,117 (GRCm39) L89P probably damaging Het
Stim1 A G 7: 102,076,498 (GRCm39) E152G probably damaging Het
Tenm3 A G 8: 49,127,528 (GRCm39) F50S probably damaging Het
Tpgs2 T G 18: 25,262,927 (GRCm39) N231H probably benign Het
Trank1 T A 9: 111,219,747 (GRCm39) N2161K probably damaging Het
Trim28 A G 7: 12,759,273 (GRCm39) D129G probably benign Het
Trim66 A T 7: 109,076,961 (GRCm39) I326N probably damaging Het
Trim80 A T 11: 115,338,843 (GRCm39) T558S probably benign Het
Uggt1 T A 1: 36,269,769 (GRCm39) T83S probably benign Het
Wdr91 A G 6: 34,863,754 (GRCm39) I587T probably damaging Het
Zpld1 A T 16: 55,052,603 (GRCm39) V337D possibly damaging Het
Other mutations in Mastl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Mastl APN 2 23,036,160 (GRCm39) missense probably damaging 1.00
IGL02103:Mastl APN 2 23,030,010 (GRCm39) missense probably benign 0.01
IGL02622:Mastl APN 2 23,022,857 (GRCm39) missense probably benign 0.12
IGL02826:Mastl APN 2 23,035,421 (GRCm39) missense probably damaging 1.00
IGL02896:Mastl APN 2 23,021,779 (GRCm39) missense probably damaging 1.00
IGL03024:Mastl APN 2 23,029,931 (GRCm39) missense probably damaging 1.00
IGL03038:Mastl APN 2 23,030,627 (GRCm39) splice site probably benign
R0600:Mastl UTSW 2 23,023,358 (GRCm39) missense probably benign 0.06
R0712:Mastl UTSW 2 23,041,005 (GRCm39) missense probably damaging 1.00
R1168:Mastl UTSW 2 23,023,144 (GRCm39) missense probably benign 0.06
R1750:Mastl UTSW 2 23,036,093 (GRCm39) nonsense probably null
R1911:Mastl UTSW 2 23,022,692 (GRCm39) nonsense probably null
R2051:Mastl UTSW 2 23,022,836 (GRCm39) missense possibly damaging 0.49
R2859:Mastl UTSW 2 23,029,979 (GRCm39) missense probably damaging 0.99
R3799:Mastl UTSW 2 23,030,504 (GRCm39) splice site probably benign
R3840:Mastl UTSW 2 23,030,563 (GRCm39) missense probably damaging 1.00
R4807:Mastl UTSW 2 23,022,855 (GRCm39) missense probably benign
R4818:Mastl UTSW 2 23,027,038 (GRCm39) missense probably benign 0.00
R4845:Mastl UTSW 2 23,030,010 (GRCm39) missense probably benign 0.01
R5338:Mastl UTSW 2 23,023,503 (GRCm39) missense probably benign 0.01
R5364:Mastl UTSW 2 23,023,665 (GRCm39) missense probably benign 0.16
R6077:Mastl UTSW 2 23,045,806 (GRCm39) missense probably damaging 0.99
R6158:Mastl UTSW 2 23,022,784 (GRCm39) missense possibly damaging 0.92
R6450:Mastl UTSW 2 23,010,941 (GRCm39) missense probably damaging 1.00
R6602:Mastl UTSW 2 23,022,689 (GRCm39) missense probably benign 0.04
R6908:Mastl UTSW 2 23,045,988 (GRCm39) start gained probably benign
R7058:Mastl UTSW 2 23,023,425 (GRCm39) nonsense probably null
R7233:Mastl UTSW 2 23,023,670 (GRCm39) missense probably benign
R7249:Mastl UTSW 2 23,036,151 (GRCm39) missense probably damaging 1.00
R7347:Mastl UTSW 2 23,023,401 (GRCm39) missense probably damaging 0.99
R7371:Mastl UTSW 2 23,030,585 (GRCm39) missense probably damaging 1.00
R7726:Mastl UTSW 2 23,030,807 (GRCm39) splice site probably null
R8057:Mastl UTSW 2 23,023,566 (GRCm39) missense possibly damaging 0.75
R8288:Mastl UTSW 2 23,023,371 (GRCm39) missense probably damaging 1.00
R9101:Mastl UTSW 2 23,008,449 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- AATGGTCATGTTCTCATTATCTGGG -3'
(R):5'- AGGCAATGTTACATTTGGAACAGTG -3'

Sequencing Primer
(F):5'- ATGTTCTCATTATCTGGGTCCCTTG -3'
(R):5'- TGGAACAGTGTGATTATAAGCAATG -3'
Posted On 2018-08-29