Incidental Mutation 'R6788:Slc9b1'
ID532476
Institutional Source Beutler Lab
Gene Symbol Slc9b1
Ensembl Gene ENSMUSG00000050150
Gene Namesolute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6788 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location135348029-135397827 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 135357757 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078568] [ENSMUST00000159658]
Predicted Effect probably null
Transcript: ENSMUST00000078568
SMART Domains Protein: ENSMUSP00000077644
Gene: ENSMUSG00000050150

DomainStartEndE-ValueType
low complexity region 32 105 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:Na_H_Exchanger 148 542 4.7e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159658
SMART Domains Protein: ENSMUSP00000124452
Gene: ENSMUSG00000050150

DomainStartEndE-ValueType
low complexity region 10 83 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.4%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium/hydrogen exchanger and transmembrane protein. Highly conserved orthologs of this gene have been found in other mammalian species. The expression of this gene may be limited to testis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C T 9: 94,524,449 V302I probably benign Het
1700016D06Rik T C 8: 11,678,584 E29G possibly damaging Het
Ahctf1 A T 1: 179,752,634 V2001E probably benign Het
Ahsg A G 16: 22,894,835 D122G probably benign Het
Ank3 A G 10: 70,004,723 Y1616C probably damaging Het
Arhgef1 A G 7: 24,919,780 probably null Het
Atp7b T C 8: 22,004,375 I1023V probably benign Het
Bod1l A T 5: 41,821,873 Y699* probably null Het
Car12 C T 9: 66,751,962 S183L probably damaging Het
Cep290 T C 10: 100,488,628 S57P probably damaging Het
Cep57l1 T C 10: 41,743,149 D74G probably damaging Het
Cers6 T C 2: 69,108,559 Y374H possibly damaging Het
Chmp4c T A 3: 10,367,135 M35K possibly damaging Het
Crkl G A 16: 17,483,781 D300N probably damaging Het
Cyp3a41a A G 5: 145,705,829 M240T probably benign Het
Dnah12 G T 14: 26,801,513 L1986F probably damaging Het
Dnah8 T C 17: 30,648,465 I297T probably benign Het
Dock10 T A 1: 80,531,245 I1610F probably damaging Het
Dpys T A 15: 39,857,163 H67L probably damaging Het
Epc2 T G 2: 49,532,087 V331G probably benign Het
Fnbp1l G A 3: 122,546,307 R344* probably null Het
Gm8765 A C 13: 50,703,095 H923P probably damaging Het
Gmip G T 8: 69,811,174 L89F possibly damaging Het
Gmip G C 8: 69,811,176 R90P probably damaging Het
Gpi1 A G 7: 34,228,990 S74P probably damaging Het
Gys1 G A 7: 45,444,678 E406K probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Klhl29 C T 12: 5,084,393 V673M probably damaging Het
Lnpk T C 2: 74,529,676 T332A probably benign Het
Loxl4 T C 19: 42,608,353 D60G probably damaging Het
Lrr1 T C 12: 69,174,675 I197T probably damaging Het
Map1lc3b A G 8: 121,593,577 N43S probably benign Het
Map3k21 A T 8: 125,939,866 D599V probably benign Het
Mastl T C 2: 23,133,698 N338D probably benign Het
Mepe A T 5: 104,338,208 R405* probably null Het
Mrps30 T C 13: 118,380,372 E437G probably benign Het
Mup15 A G 4: 61,438,228 V100A possibly damaging Het
Olfml1 A T 7: 107,567,868 I35F probably damaging Het
Olfml2a T A 2: 38,960,226 Y651* probably null Het
Olfr93 T A 17: 37,151,822 D50V probably damaging Het
Otog T C 7: 46,298,317 V113A probably damaging Het
Parvg C T 15: 84,326,263 L44F possibly damaging Het
Pcnx2 G T 8: 125,772,100 D1553E probably damaging Het
Pcyt2 C T 11: 120,614,374 G122S probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Polq C T 16: 37,077,148 T2134I probably damaging Het
Prkce T G 17: 86,630,061 F641V probably damaging Het
Prss1 T C 6: 41,463,720 I243T possibly damaging Het
Pxmp2 A G 5: 110,281,319 F91L probably benign Het
Ralgapb G A 2: 158,436,566 G5R probably damaging Het
Rasgef1a T G 6: 118,087,213 M337R possibly damaging Het
Rassf2 A G 2: 132,002,925 M199T probably damaging Het
Rtbdn A T 8: 84,952,674 Y67F probably null Het
Scamp3 T C 3: 89,181,949 V271A probably benign Het
Sema3a A T 5: 13,597,616 R613W possibly damaging Het
Slc4a3 A T 1: 75,551,315 I206F probably damaging Het
Smchd1 C A 17: 71,475,101 V22F probably benign Het
Smg1 A G 7: 118,184,571 probably benign Het
Stab1 A G 14: 31,139,160 L89P probably damaging Het
Stim1 A G 7: 102,427,291 E152G probably damaging Het
Tenm3 A G 8: 48,674,493 F50S probably damaging Het
Tpgs2 T G 18: 25,129,870 N231H probably benign Het
Trank1 T A 9: 111,390,679 N2161K probably damaging Het
Trim28 A G 7: 13,025,346 D129G probably benign Het
Trim66 A T 7: 109,477,754 I326N probably damaging Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Uggt1 T A 1: 36,230,688 T83S probably benign Het
Wdr91 A G 6: 34,886,819 I587T probably damaging Het
Zpld1 A T 16: 55,232,240 V337D possibly damaging Het
Other mutations in Slc9b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Slc9b1 APN 3 135371982 unclassified probably null
IGL02793:Slc9b1 APN 3 135374406 unclassified probably benign
IGL02875:Slc9b1 APN 3 135374406 unclassified probably benign
IGL02977:Slc9b1 APN 3 135397723 missense probably damaging 1.00
IGL02990:Slc9b1 APN 3 135394983 splice site probably null
IGL03112:Slc9b1 APN 3 135397672 missense probably damaging 1.00
IGL03277:Slc9b1 APN 3 135390508 missense possibly damaging 0.46
IGL03409:Slc9b1 APN 3 135394909 missense probably damaging 0.99
R0190:Slc9b1 UTSW 3 135357673 missense unknown
R0329:Slc9b1 UTSW 3 135373235 nonsense probably null
R0591:Slc9b1 UTSW 3 135382832 missense possibly damaging 0.88
R0592:Slc9b1 UTSW 3 135394074 splice site probably benign
R0602:Slc9b1 UTSW 3 135397755 missense probably benign 0.00
R0893:Slc9b1 UTSW 3 135394890 missense probably benign 0.15
R1250:Slc9b1 UTSW 3 135348770 start codon destroyed probably null
R1619:Slc9b1 UTSW 3 135355004 splice site probably null
R1840:Slc9b1 UTSW 3 135357468 missense unknown
R3157:Slc9b1 UTSW 3 135371845 missense probably damaging 1.00
R3159:Slc9b1 UTSW 3 135371845 missense probably damaging 1.00
R4565:Slc9b1 UTSW 3 135382717 missense probably damaging 1.00
R5138:Slc9b1 UTSW 3 135357773 intron probably benign
R5154:Slc9b1 UTSW 3 135373179 missense probably damaging 1.00
R5429:Slc9b1 UTSW 3 135373263 critical splice donor site probably null
R5677:Slc9b1 UTSW 3 135357559 missense unknown
R5903:Slc9b1 UTSW 3 135392894 intron probably benign
R5933:Slc9b1 UTSW 3 135393995 missense probably benign 0.30
R6593:Slc9b1 UTSW 3 135357458 start codon destroyed probably null
R6667:Slc9b1 UTSW 3 135371965 missense probably damaging 0.99
RF006:Slc9b1 UTSW 3 135357542 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GTCCAAAGATCCTGATAGTTTTCAT -3'
(R):5'- AGAACCTTCGTATTGTCAGGAA -3'

Sequencing Primer
(F):5'- GTTTTCATGAAGAAACTGTGGAACC -3'
(R):5'- GAGCCTTCAACTAACATGGCTTC -3'
Posted On2018-08-29