Mutagenetix > Incidental Mutation

Incidental Mutation 'R6788:Stim1'

532491

Institutional Source

Beutler Lab

Gene Symbol

Stim1

Ensembl Gene

ENSMUSG00000030987

Gene Name

stromal interaction molecule 1

Synonyms

SIM

MMRRC Submission

044902-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6788 (G1)

Quality Score

192.009

Status

Validated

Chromosome

Chromosomal Location

102267806-102437319 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102427291 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 152 (E152G)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]

AlphaFold

P70302

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033289
AA Change: E483G

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987
AA Change: E483G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	32	47	N/A	INTRINSIC
SAM	129	200	5.51e-6	SMART
SCOP:d1eq1a_	229	334	1e-2	SMART
PDB:4O9B\|D	237	340	3e-59	PDB
Pfam:SOAR	341	441	1.4e-46	PFAM
low complexity region	485	499	N/A	INTRINSIC
low complexity region	601	631	N/A	INTRINSIC
low complexity region	672	685	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209255
AA Change: E483G

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211058
AA Change: E152G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

Predicted Effect

probably benign
Transcript: ENSMUST00000211457
AA Change: E483G

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)

Meta Mutation Damage Score

0.0936

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.9%
20x: 97.4%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	C	T	9: 94,524,449	V302I	probably benign	Het
1700016D06Rik	T	C	8: 11,678,584	E29G	possibly damaging	Het
Ahctf1	A	T	1: 179,752,634	V2001E	probably benign	Het
Ahsg	A	G	16: 22,894,835	D122G	probably benign	Het
Ank3	A	G	10: 70,004,723	Y1616C	probably damaging	Het
Arhgef1	A	G	7: 24,919,780		probably null	Het
Atp7b	T	C	8: 22,004,375	I1023V	probably benign	Het
Bod1l	A	T	5: 41,821,873	Y699*	probably null	Het
Car12	C	T	9: 66,751,962	S183L	probably damaging	Het
Cep290	T	C	10: 100,488,628	S57P	probably damaging	Het
Cep57l1	T	C	10: 41,743,149	D74G	probably damaging	Het
Cers6	T	C	2: 69,108,559	Y374H	possibly damaging	Het
Chmp4c	T	A	3: 10,367,135	M35K	possibly damaging	Het
Crkl	G	A	16: 17,483,781	D300N	probably damaging	Het
Cyp3a41a	A	G	5: 145,705,829	M240T	probably benign	Het
Dnah12	G	T	14: 26,801,513	L1986F	probably damaging	Het
Dnah8	T	C	17: 30,648,465	I297T	probably benign	Het
Dock10	T	A	1: 80,531,245	I1610F	probably damaging	Het
Dpys	T	A	15: 39,857,163	H67L	probably damaging	Het
Epc2	T	G	2: 49,532,087	V331G	probably benign	Het
Fnbp1l	G	A	3: 122,546,307	R344*	probably null	Het
Gm8765	A	C	13: 50,703,095	H923P	probably damaging	Het
Gmip	G	T	8: 69,811,174	L89F	possibly damaging	Het
Gmip	G	C	8: 69,811,176	R90P	probably damaging	Het
Gpi1	A	G	7: 34,228,990	S74P	probably damaging	Het
Gys1	G	A	7: 45,444,678	E406K	probably damaging	Het
Hspg2	G	A	4: 137,515,307	G611E	probably damaging	Het
Klhl29	C	T	12: 5,084,393	V673M	probably damaging	Het
Lnpk	T	C	2: 74,529,676	T332A	probably benign	Het
Loxl4	T	C	19: 42,608,353	D60G	probably damaging	Het
Lrr1	T	C	12: 69,174,675	I197T	probably damaging	Het
Map1lc3b	A	G	8: 121,593,577	N43S	probably benign	Het
Map3k21	A	T	8: 125,939,866	D599V	probably benign	Het
Mastl	T	C	2: 23,133,698	N338D	probably benign	Het
Mepe	A	T	5: 104,338,208	R405*	probably null	Het
Mrps30	T	C	13: 118,380,372	E437G	probably benign	Het
Mup15	A	G	4: 61,438,228	V100A	possibly damaging	Het
Olfml1	A	T	7: 107,567,868	I35F	probably damaging	Het
Olfml2a	T	A	2: 38,960,226	Y651*	probably null	Het
Olfr93	T	A	17: 37,151,822	D50V	probably damaging	Het
Otog	T	C	7: 46,298,317	V113A	probably damaging	Het
Parvg	C	T	15: 84,326,263	L44F	possibly damaging	Het
Pcnx2	G	T	8: 125,772,100	D1553E	probably damaging	Het
Pcyt2	C	T	11: 120,614,374	G122S	probably damaging	Het
Pi4ka	A	G	16: 17,376,982	L184P	possibly damaging	Het
Polq	C	T	16: 37,077,148	T2134I	probably damaging	Het
Prkce	T	G	17: 86,630,061	F641V	probably damaging	Het
Prss1	T	C	6: 41,463,720	I243T	possibly damaging	Het
Pxmp2	A	G	5: 110,281,319	F91L	probably benign	Het
Ralgapb	G	A	2: 158,436,566	G5R	probably damaging	Het
Rasgef1a	T	G	6: 118,087,213	M337R	possibly damaging	Het
Rassf2	A	G	2: 132,002,925	M199T	probably damaging	Het
Rtbdn	A	T	8: 84,952,674	Y67F	probably null	Het
Scamp3	T	C	3: 89,181,949	V271A	probably benign	Het
Sema3a	A	T	5: 13,597,616	R613W	possibly damaging	Het
Slc4a3	A	T	1: 75,551,315	I206F	probably damaging	Het
Slc9b1	A	G	3: 135,357,757		probably null	Het
Smchd1	C	A	17: 71,475,101	V22F	probably benign	Het
Smg1	A	G	7: 118,184,571		probably benign	Het
Stab1	A	G	14: 31,139,160	L89P	probably damaging	Het
Tenm3	A	G	8: 48,674,493	F50S	probably damaging	Het
Tpgs2	T	G	18: 25,129,870	N231H	probably benign	Het
Trank1	T	A	9: 111,390,679	N2161K	probably damaging	Het
Trim28	A	G	7: 13,025,346	D129G	probably benign	Het
Trim66	A	T	7: 109,477,754	I326N	probably damaging	Het
Trim80	A	T	11: 115,448,017	T558S	probably benign	Het
Uggt1	T	A	1: 36,230,688	T83S	probably benign	Het
Wdr91	A	G	6: 34,886,819	I587T	probably damaging	Het
Zpld1	A	T	16: 55,232,240	V337D	possibly damaging	Het

Other mutations in Stim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Stim1	APN	7	102426747	missense	probably damaging	1.00
IGL01390:Stim1	APN	7	102427162	missense	possibly damaging	0.73
IGL01602:Stim1	APN	7	102386115	missense	possibly damaging	0.86
IGL01605:Stim1	APN	7	102386115	missense	possibly damaging	0.86
IGL01697:Stim1	APN	7	102425969	splice site	probably benign
IGL01826:Stim1	APN	7	102427075	splice site	probably benign
IGL01908:Stim1	APN	7	102435650	missense	probably benign
IGL02869:Stim1	APN	7	102268551	missense	unknown
IGL03146:Stim1	APN	7	102421355	missense	probably damaging	1.00
R0217:Stim1	UTSW	7	102435800	missense	probably benign	0.00
R1320:Stim1	UTSW	7	102408406	missense	possibly damaging	0.79
R1639:Stim1	UTSW	7	102354541	missense	probably benign	0.31
R1643:Stim1	UTSW	7	102386100	missense	possibly damaging	0.92
R1697:Stim1	UTSW	7	102354506	missense	probably damaging	1.00
R2424:Stim1	UTSW	7	102408405	missense	probably benign	0.03
R3838:Stim1	UTSW	7	102411296	missense	possibly damaging	0.71
R3940:Stim1	UTSW	7	102435641	missense	probably benign	0.00
R4820:Stim1	UTSW	7	102415364	missense	probably damaging	0.97
R4871:Stim1	UTSW	7	102354572	missense	probably damaging	1.00
R5110:Stim1	UTSW	7	102268422	missense	unknown
R5787:Stim1	UTSW	7	102435440	missense	possibly damaging	0.52
R6400:Stim1	UTSW	7	102430950	missense	probably null	0.99
R7112:Stim1	UTSW	7	102408408	missense	probably benign	0.01
R7125:Stim1	UTSW	7	102435534	missense	possibly damaging	0.69
R7247:Stim1	UTSW	7	102421532	critical splice donor site	probably null
R7650:Stim1	UTSW	7	102428827	missense
R7807:Stim1	UTSW	7	102427141	missense	probably damaging	0.99
R8304:Stim1	UTSW	7	102435481	missense	possibly damaging	0.55
R8462:Stim1	UTSW	7	102427117	missense	probably damaging	1.00
R8528:Stim1	UTSW	7	102431082	intron	probably benign
R8883:Stim1	UTSW	7	102431050	missense	unknown
R8921:Stim1	UTSW	7	102421390	missense	probably damaging	0.99
R8924:Stim1	UTSW	7	102428807	missense
R9018:Stim1	UTSW	7	102411275	missense	probably benign	0.05
R9164:Stim1	UTSW	7	102435419	missense	probably benign	0.35
R9396:Stim1	UTSW	7	102415385	missense	possibly damaging	0.63
R9487:Stim1	UTSW	7	102431050	missense	unknown
R9501:Stim1	UTSW	7	102411299	missense	possibly damaging	0.92
R9697:Stim1	UTSW	7	102428807	missense
R9710:Stim1	UTSW	7	102430911	small deletion	probably benign
R9734:Stim1	UTSW	7	102415353	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- TGAGGTGACAGCGGCACT -3'
(R):5'- ACCACCAAAAGGACAGCTGT -3'

Sequencing Primer
(F):5'- CACTGAGGGAGCGCCTG -3'
(R):5'- TTTAAGCACAGCAGAGGC -3'

Posted On

2018-08-29