Incidental Mutation 'R6788:Stim1'
ID532491
Institutional Source Beutler Lab
Gene Symbol Stim1
Ensembl Gene ENSMUSG00000030987
Gene Namestromal interaction molecule 1
SynonymsSIM
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6788 (G1)
Quality Score192.009
Status Validated
Chromosome7
Chromosomal Location102267806-102437319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102427291 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 152 (E152G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033289
AA Change: E483G

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987
AA Change: E483G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
SAM 129 200 5.51e-6 SMART
SCOP:d1eq1a_ 229 334 1e-2 SMART
PDB:4O9B|D 237 340 3e-59 PDB
Pfam:SOAR 341 441 1.4e-46 PFAM
low complexity region 485 499 N/A INTRINSIC
low complexity region 601 631 N/A INTRINSIC
low complexity region 672 685 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209255
AA Change: E483G

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000211058
AA Change: E152G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000211457
AA Change: E483G

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0936 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.4%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C T 9: 94,524,449 V302I probably benign Het
1700016D06Rik T C 8: 11,678,584 E29G possibly damaging Het
Ahctf1 A T 1: 179,752,634 V2001E probably benign Het
Ahsg A G 16: 22,894,835 D122G probably benign Het
Ank3 A G 10: 70,004,723 Y1616C probably damaging Het
Arhgef1 A G 7: 24,919,780 probably null Het
Atp7b T C 8: 22,004,375 I1023V probably benign Het
Bod1l A T 5: 41,821,873 Y699* probably null Het
Car12 C T 9: 66,751,962 S183L probably damaging Het
Cep290 T C 10: 100,488,628 S57P probably damaging Het
Cep57l1 T C 10: 41,743,149 D74G probably damaging Het
Cers6 T C 2: 69,108,559 Y374H possibly damaging Het
Chmp4c T A 3: 10,367,135 M35K possibly damaging Het
Crkl G A 16: 17,483,781 D300N probably damaging Het
Cyp3a41a A G 5: 145,705,829 M240T probably benign Het
Dnah12 G T 14: 26,801,513 L1986F probably damaging Het
Dnah8 T C 17: 30,648,465 I297T probably benign Het
Dock10 T A 1: 80,531,245 I1610F probably damaging Het
Dpys T A 15: 39,857,163 H67L probably damaging Het
Epc2 T G 2: 49,532,087 V331G probably benign Het
Fnbp1l G A 3: 122,546,307 R344* probably null Het
Gm8765 A C 13: 50,703,095 H923P probably damaging Het
Gmip G T 8: 69,811,174 L89F possibly damaging Het
Gmip G C 8: 69,811,176 R90P probably damaging Het
Gpi1 A G 7: 34,228,990 S74P probably damaging Het
Gys1 G A 7: 45,444,678 E406K probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Klhl29 C T 12: 5,084,393 V673M probably damaging Het
Lnpk T C 2: 74,529,676 T332A probably benign Het
Loxl4 T C 19: 42,608,353 D60G probably damaging Het
Lrr1 T C 12: 69,174,675 I197T probably damaging Het
Map1lc3b A G 8: 121,593,577 N43S probably benign Het
Map3k21 A T 8: 125,939,866 D599V probably benign Het
Mastl T C 2: 23,133,698 N338D probably benign Het
Mepe A T 5: 104,338,208 R405* probably null Het
Mrps30 T C 13: 118,380,372 E437G probably benign Het
Mup15 A G 4: 61,438,228 V100A possibly damaging Het
Olfml1 A T 7: 107,567,868 I35F probably damaging Het
Olfml2a T A 2: 38,960,226 Y651* probably null Het
Olfr93 T A 17: 37,151,822 D50V probably damaging Het
Otog T C 7: 46,298,317 V113A probably damaging Het
Parvg C T 15: 84,326,263 L44F possibly damaging Het
Pcnx2 G T 8: 125,772,100 D1553E probably damaging Het
Pcyt2 C T 11: 120,614,374 G122S probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Polq C T 16: 37,077,148 T2134I probably damaging Het
Prkce T G 17: 86,630,061 F641V probably damaging Het
Prss1 T C 6: 41,463,720 I243T possibly damaging Het
Pxmp2 A G 5: 110,281,319 F91L probably benign Het
Ralgapb G A 2: 158,436,566 G5R probably damaging Het
Rasgef1a T G 6: 118,087,213 M337R possibly damaging Het
Rassf2 A G 2: 132,002,925 M199T probably damaging Het
Rtbdn A T 8: 84,952,674 Y67F probably null Het
Scamp3 T C 3: 89,181,949 V271A probably benign Het
Sema3a A T 5: 13,597,616 R613W possibly damaging Het
Slc4a3 A T 1: 75,551,315 I206F probably damaging Het
Slc9b1 A G 3: 135,357,757 probably null Het
Smchd1 C A 17: 71,475,101 V22F probably benign Het
Smg1 A G 7: 118,184,571 probably benign Het
Stab1 A G 14: 31,139,160 L89P probably damaging Het
Tenm3 A G 8: 48,674,493 F50S probably damaging Het
Tpgs2 T G 18: 25,129,870 N231H probably benign Het
Trank1 T A 9: 111,390,679 N2161K probably damaging Het
Trim28 A G 7: 13,025,346 D129G probably benign Het
Trim66 A T 7: 109,477,754 I326N probably damaging Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Uggt1 T A 1: 36,230,688 T83S probably benign Het
Wdr91 A G 6: 34,886,819 I587T probably damaging Het
Zpld1 A T 16: 55,232,240 V337D possibly damaging Het
Other mutations in Stim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Stim1 APN 7 102426747 missense probably damaging 1.00
IGL01390:Stim1 APN 7 102427162 missense possibly damaging 0.73
IGL01602:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01605:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01697:Stim1 APN 7 102425969 splice site probably benign
IGL01826:Stim1 APN 7 102427075 splice site probably benign
IGL01908:Stim1 APN 7 102435650 missense probably benign
IGL02869:Stim1 APN 7 102268551 missense unknown
IGL03146:Stim1 APN 7 102421355 missense probably damaging 1.00
R0217:Stim1 UTSW 7 102435800 missense probably benign 0.00
R1320:Stim1 UTSW 7 102408406 missense possibly damaging 0.79
R1639:Stim1 UTSW 7 102354541 missense probably benign 0.31
R1643:Stim1 UTSW 7 102386100 missense possibly damaging 0.92
R1697:Stim1 UTSW 7 102354506 missense probably damaging 1.00
R2424:Stim1 UTSW 7 102408405 missense probably benign 0.03
R3838:Stim1 UTSW 7 102411296 missense possibly damaging 0.71
R3940:Stim1 UTSW 7 102435641 missense probably benign 0.00
R4820:Stim1 UTSW 7 102415364 missense probably damaging 0.97
R4871:Stim1 UTSW 7 102354572 missense probably damaging 1.00
R5110:Stim1 UTSW 7 102268422 missense unknown
R5787:Stim1 UTSW 7 102435440 missense possibly damaging 0.52
R6400:Stim1 UTSW 7 102430950 missense probably null 0.99
R7112:Stim1 UTSW 7 102408408 missense probably benign 0.01
R7125:Stim1 UTSW 7 102435534 missense possibly damaging 0.69
R7247:Stim1 UTSW 7 102421532 critical splice donor site probably null
R7650:Stim1 UTSW 7 102428827 missense
R7807:Stim1 UTSW 7 102427141 missense probably damaging 0.99
R8304:Stim1 UTSW 7 102435481 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TGAGGTGACAGCGGCACT -3'
(R):5'- ACCACCAAAAGGACAGCTGT -3'

Sequencing Primer
(F):5'- CACTGAGGGAGCGCCTG -3'
(R):5'- TTTAAGCACAGCAGAGGC -3'
Posted On2018-08-29