Incidental Mutation 'R6788:Trim66'
ID532493
Institutional Source Beutler Lab
Gene Symbol Trim66
Ensembl Gene ENSMUSG00000031026
Gene Nametripartite motif-containing 66
SynonymsTif1d, D7H11orf29
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R6788 (G1)
Quality Score161.009
Status Validated
Chromosome7
Chromosomal Location109449006-109508134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109477754 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 326 (I326N)
Ref Sequence ENSEMBL: ENSMUSP00000102352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033339] [ENSMUST00000106739] [ENSMUST00000106741]
Predicted Effect probably damaging
Transcript: ENSMUST00000033339
AA Change: I224N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033339
Gene: ENSMUSG00000031026
AA Change: I224N

DomainStartEndE-ValueType
PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106739
AA Change: I224N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102350
Gene: ENSMUSG00000031026
AA Change: I224N

DomainStartEndE-ValueType
PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106741
AA Change: I326N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102352
Gene: ENSMUSG00000031026
AA Change: I326N

DomainStartEndE-ValueType
RING 28 78 2.38e-2 SMART
BBOX 102 140 1.48e0 SMART
PHD 106 171 7.77e0 SMART
RING 107 170 4.38e0 SMART
BBOX 162 203 4.21e-3 SMART
BBC 210 336 1.61e-39 SMART
low complexity region 420 435 N/A INTRINSIC
low complexity region 554 588 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
PHD 1100 1143 4.09e-10 SMART
BROMO 1171 1277 8.22e-27 SMART
low complexity region 1287 1301 N/A INTRINSIC
Meta Mutation Damage Score 0.3714 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.4%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C T 9: 94,524,449 V302I probably benign Het
1700016D06Rik T C 8: 11,678,584 E29G possibly damaging Het
Ahctf1 A T 1: 179,752,634 V2001E probably benign Het
Ahsg A G 16: 22,894,835 D122G probably benign Het
Ank3 A G 10: 70,004,723 Y1616C probably damaging Het
Arhgef1 A G 7: 24,919,780 probably null Het
Atp7b T C 8: 22,004,375 I1023V probably benign Het
Bod1l A T 5: 41,821,873 Y699* probably null Het
Car12 C T 9: 66,751,962 S183L probably damaging Het
Cep290 T C 10: 100,488,628 S57P probably damaging Het
Cep57l1 T C 10: 41,743,149 D74G probably damaging Het
Cers6 T C 2: 69,108,559 Y374H possibly damaging Het
Chmp4c T A 3: 10,367,135 M35K possibly damaging Het
Crkl G A 16: 17,483,781 D300N probably damaging Het
Cyp3a41a A G 5: 145,705,829 M240T probably benign Het
Dnah12 G T 14: 26,801,513 L1986F probably damaging Het
Dnah8 T C 17: 30,648,465 I297T probably benign Het
Dock10 T A 1: 80,531,245 I1610F probably damaging Het
Dpys T A 15: 39,857,163 H67L probably damaging Het
Epc2 T G 2: 49,532,087 V331G probably benign Het
Fnbp1l G A 3: 122,546,307 R344* probably null Het
Gm8765 A C 13: 50,703,095 H923P probably damaging Het
Gmip G T 8: 69,811,174 L89F possibly damaging Het
Gmip G C 8: 69,811,176 R90P probably damaging Het
Gpi1 A G 7: 34,228,990 S74P probably damaging Het
Gys1 G A 7: 45,444,678 E406K probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Klhl29 C T 12: 5,084,393 V673M probably damaging Het
Lnpk T C 2: 74,529,676 T332A probably benign Het
Loxl4 T C 19: 42,608,353 D60G probably damaging Het
Lrr1 T C 12: 69,174,675 I197T probably damaging Het
Map1lc3b A G 8: 121,593,577 N43S probably benign Het
Map3k21 A T 8: 125,939,866 D599V probably benign Het
Mastl T C 2: 23,133,698 N338D probably benign Het
Mepe A T 5: 104,338,208 R405* probably null Het
Mrps30 T C 13: 118,380,372 E437G probably benign Het
Mup15 A G 4: 61,438,228 V100A possibly damaging Het
Olfml1 A T 7: 107,567,868 I35F probably damaging Het
Olfml2a T A 2: 38,960,226 Y651* probably null Het
Olfr93 T A 17: 37,151,822 D50V probably damaging Het
Otog T C 7: 46,298,317 V113A probably damaging Het
Parvg C T 15: 84,326,263 L44F possibly damaging Het
Pcnx2 G T 8: 125,772,100 D1553E probably damaging Het
Pcyt2 C T 11: 120,614,374 G122S probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Polq C T 16: 37,077,148 T2134I probably damaging Het
Prkce T G 17: 86,630,061 F641V probably damaging Het
Prss1 T C 6: 41,463,720 I243T possibly damaging Het
Pxmp2 A G 5: 110,281,319 F91L probably benign Het
Ralgapb G A 2: 158,436,566 G5R probably damaging Het
Rasgef1a T G 6: 118,087,213 M337R possibly damaging Het
Rassf2 A G 2: 132,002,925 M199T probably damaging Het
Rtbdn A T 8: 84,952,674 Y67F probably null Het
Scamp3 T C 3: 89,181,949 V271A probably benign Het
Sema3a A T 5: 13,597,616 R613W possibly damaging Het
Slc4a3 A T 1: 75,551,315 I206F probably damaging Het
Slc9b1 A G 3: 135,357,757 probably null Het
Smchd1 C A 17: 71,475,101 V22F probably benign Het
Smg1 A G 7: 118,184,571 probably benign Het
Stab1 A G 14: 31,139,160 L89P probably damaging Het
Stim1 A G 7: 102,427,291 E152G probably damaging Het
Tenm3 A G 8: 48,674,493 F50S probably damaging Het
Tpgs2 T G 18: 25,129,870 N231H probably benign Het
Trank1 T A 9: 111,390,679 N2161K probably damaging Het
Trim28 A G 7: 13,025,346 D129G probably benign Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Uggt1 T A 1: 36,230,688 T83S probably benign Het
Wdr91 A G 6: 34,886,819 I587T probably damaging Het
Zpld1 A T 16: 55,232,240 V337D possibly damaging Het
Other mutations in Trim66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Trim66 APN 7 109455066 missense probably benign 0.02
IGL01758:Trim66 APN 7 109486045 critical splice donor site probably null
IGL01982:Trim66 APN 7 109458763 missense probably benign 0.00
IGL01983:Trim66 APN 7 109458251 nonsense probably null
IGL02149:Trim66 APN 7 109460902 missense possibly damaging 0.66
IGL02392:Trim66 APN 7 109460274 missense probably benign 0.01
IGL02483:Trim66 APN 7 109477630 splice site probably benign
IGL02832:Trim66 APN 7 109460497 missense probably damaging 1.00
IGL02945:Trim66 APN 7 109460176 nonsense probably null
IGL03085:Trim66 APN 7 109458745 missense probably benign 0.17
PIT1430001:Trim66 UTSW 7 109475247 missense probably damaging 0.99
R0326:Trim66 UTSW 7 109460172 missense probably benign 0.00
R0358:Trim66 UTSW 7 109460176 nonsense probably null
R0401:Trim66 UTSW 7 109475264 missense probably damaging 0.98
R0470:Trim66 UTSW 7 109457542 splice site probably benign
R0568:Trim66 UTSW 7 109460695 missense probably benign 0.00
R0669:Trim66 UTSW 7 109454992 intron probably benign
R0980:Trim66 UTSW 7 109455670 missense probably damaging 1.00
R1015:Trim66 UTSW 7 109455233 missense probably damaging 1.00
R1078:Trim66 UTSW 7 109472319 missense probably damaging 1.00
R1099:Trim66 UTSW 7 109475454 missense probably benign 0.34
R1181:Trim66 UTSW 7 109484577 critical splice donor site probably null
R1497:Trim66 UTSW 7 109484619 missense probably benign 0.00
R1583:Trim66 UTSW 7 109455080 missense probably damaging 1.00
R1843:Trim66 UTSW 7 109475839 missense probably damaging 0.99
R1998:Trim66 UTSW 7 109484577 critical splice donor site probably null
R2016:Trim66 UTSW 7 109472232 critical splice donor site probably null
R2143:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R2144:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R2145:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R3945:Trim66 UTSW 7 109472268 missense possibly damaging 0.94
R4012:Trim66 UTSW 7 109458131 missense probably damaging 0.98
R4464:Trim66 UTSW 7 109477690 missense possibly damaging 0.51
R4473:Trim66 UTSW 7 109481995 missense probably damaging 1.00
R4729:Trim66 UTSW 7 109456060 critical splice donor site probably null
R4730:Trim66 UTSW 7 109483069 missense probably damaging 1.00
R4775:Trim66 UTSW 7 109457589 nonsense probably null
R4819:Trim66 UTSW 7 109457586 missense probably damaging 1.00
R5269:Trim66 UTSW 7 109457590 missense probably benign 0.00
R5557:Trim66 UTSW 7 109483737 missense probably benign 0.06
R5832:Trim66 UTSW 7 109455202 missense probably damaging 1.00
R6220:Trim66 UTSW 7 109483093 missense probably damaging 0.97
R6243:Trim66 UTSW 7 109460274 missense probably benign 0.01
R6374:Trim66 UTSW 7 109486062 missense probably benign
R6450:Trim66 UTSW 7 109460738 missense probably benign 0.09
R6543:Trim66 UTSW 7 109475879 missense probably benign 0.01
R6842:Trim66 UTSW 7 109460776 missense probably benign 0.00
R7169:Trim66 UTSW 7 109455121 missense probably benign 0.25
R7257:Trim66 UTSW 7 109460244 missense probably damaging 1.00
R7328:Trim66 UTSW 7 109457751 missense probably damaging 0.99
R7616:Trim66 UTSW 7 109483749 missense probably damaging 0.99
RF013:Trim66 UTSW 7 109460753 missense probably damaging 0.99
RF024:Trim66 UTSW 7 109460740 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TTCTCTTAGGCATGTGCTGACC -3'
(R):5'- ATGAGTGTAGGGTTCCAGAGC -3'

Sequencing Primer
(F):5'- CATGTGCTGACCCACCTAG -3'
(R):5'- TTCCAGAGCTTTGGGAAGAG -3'
Posted On2018-08-29