Mutagenetix > Incidental Mutation

Incidental Mutation 'R6788:Cep290'

532509

Institutional Source

Beutler Lab

Gene Symbol

Cep290

Ensembl Gene

ENSMUSG00000019971

Gene Name

centrosomal protein 290

Synonyms

b2b1454Clo, Nphp6, b2b1752Clo

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.941) question?

Stock #

R6788 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100487558-100574840 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100488628 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 57 (S57P)

Ref Sequence

ENSEMBL: ENSMUSP00000151388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058154] [ENSMUST00000099318] [ENSMUST00000128009] [ENSMUST00000134477] [ENSMUST00000164751] [ENSMUST00000219765] [ENSMUST00000220346]

AlphaFold

Q6A078

Predicted Effect

probably benign
Transcript: ENSMUST00000058154

SMART Domains

Protein: ENSMUSP00000061470
Gene: ENSMUSG00000036676

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
transmembrane domain	98	120	N/A	INTRINSIC
transmembrane domain	141	163	N/A	INTRINSIC
transmembrane domain	173	192	N/A	INTRINSIC
transmembrane domain	205	227	N/A	INTRINSIC
transmembrane domain	237	259	N/A	INTRINSIC
Pfam:DUF1736	263	336	5.4e-35	PFAM
transmembrane domain	353	375	N/A	INTRINSIC
transmembrane domain	382	399	N/A	INTRINSIC
TPR	451	484	8.23e-6	SMART
TPR	485	518	2.13e1	SMART
TPR	533	567	8.77e1	SMART
TPR	568	601	3.19e-3	SMART
TPR	602	635	1.06e-8	SMART
TPR	673	706	1.35e-1	SMART
TPR	707	740	1.44e1	SMART
TPR	741	775	1.51e1	SMART
TPR	776	809	9e1	SMART
low complexity region	867	880	N/A	INTRINSIC
low complexity region	891	902	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099318

SMART Domains

Protein: ENSMUSP00000096921
Gene: ENSMUSG00000036676

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
transmembrane domain	98	120	N/A	INTRINSIC
transmembrane domain	141	163	N/A	INTRINSIC
transmembrane domain	173	192	N/A	INTRINSIC
transmembrane domain	205	227	N/A	INTRINSIC
transmembrane domain	237	259	N/A	INTRINSIC
Pfam:DUF1736	261	338	2.6e-33	PFAM
transmembrane domain	353	375	N/A	INTRINSIC
transmembrane domain	382	399	N/A	INTRINSIC
TPR	451	484	8.23e-6	SMART
TPR	485	518	2.13e1	SMART
TPR	533	567	8.77e1	SMART
TPR	568	601	3.19e-3	SMART
TPR	602	635	1.06e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128009

Predicted Effect

probably benign
Transcript: ENSMUST00000134477

Predicted Effect

probably damaging
Transcript: ENSMUST00000164751
AA Change: S57P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: S57P

Domain	Start	End	E-Value	Type
coiled coil region	59	298	N/A	INTRINSIC
coiled coil region	319	566	N/A	INTRINSIC
coiled coil region	598	662	N/A	INTRINSIC
coiled coil region	697	754	N/A	INTRINSIC
coiled coil region	780	875	N/A	INTRINSIC
internal_repeat_2	884	894	1.1e-5	PROSPERO
coiled coil region	986	1028	N/A	INTRINSIC
internal_repeat_2	1057	1067	1.1e-5	PROSPERO
coiled coil region	1071	1109	N/A	INTRINSIC
low complexity region	1140	1156	N/A	INTRINSIC
internal_repeat_1	1176	1206	8.72e-8	PROSPERO
coiled coil region	1221	1250	N/A	INTRINSIC
Pfam:CEP209_CC5	1290	1417	3.8e-55	PFAM
low complexity region	1476	1493	N/A	INTRINSIC
internal_repeat_1	1498	1525	8.72e-8	PROSPERO
coiled coil region	1535	1595	N/A	INTRINSIC
coiled coil region	1624	1716	N/A	INTRINSIC
coiled coil region	1776	2328	N/A	INTRINSIC
low complexity region	2333	2347	N/A	INTRINSIC
coiled coil region	2377	2453	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219765
AA Change: S57P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000220346
AA Change: S57P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.9%
20x: 97.4%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	C	T	9: 94,524,449	V302I	probably benign	Het
1700016D06Rik	T	C	8: 11,678,584	E29G	possibly damaging	Het
Ahctf1	A	T	1: 179,752,634	V2001E	probably benign	Het
Ahsg	A	G	16: 22,894,835	D122G	probably benign	Het
Ank3	A	G	10: 70,004,723	Y1616C	probably damaging	Het
Arhgef1	A	G	7: 24,919,780		probably null	Het
Atp7b	T	C	8: 22,004,375	I1023V	probably benign	Het
Bod1l	A	T	5: 41,821,873	Y699*	probably null	Het
Car12	C	T	9: 66,751,962	S183L	probably damaging	Het
Cep57l1	T	C	10: 41,743,149	D74G	probably damaging	Het
Cers6	T	C	2: 69,108,559	Y374H	possibly damaging	Het
Chmp4c	T	A	3: 10,367,135	M35K	possibly damaging	Het
Crkl	G	A	16: 17,483,781	D300N	probably damaging	Het
Cyp3a41a	A	G	5: 145,705,829	M240T	probably benign	Het
Dnah12	G	T	14: 26,801,513	L1986F	probably damaging	Het
Dnah8	T	C	17: 30,648,465	I297T	probably benign	Het
Dock10	T	A	1: 80,531,245	I1610F	probably damaging	Het
Dpys	T	A	15: 39,857,163	H67L	probably damaging	Het
Epc2	T	G	2: 49,532,087	V331G	probably benign	Het
Fnbp1l	G	A	3: 122,546,307	R344*	probably null	Het
Gm8765	A	C	13: 50,703,095	H923P	probably damaging	Het
Gmip	G	T	8: 69,811,174	L89F	possibly damaging	Het
Gmip	G	C	8: 69,811,176	R90P	probably damaging	Het
Gpi1	A	G	7: 34,228,990	S74P	probably damaging	Het
Gys1	G	A	7: 45,444,678	E406K	probably damaging	Het
Hspg2	G	A	4: 137,515,307	G611E	probably damaging	Het
Klhl29	C	T	12: 5,084,393	V673M	probably damaging	Het
Lnpk	T	C	2: 74,529,676	T332A	probably benign	Het
Loxl4	T	C	19: 42,608,353	D60G	probably damaging	Het
Lrr1	T	C	12: 69,174,675	I197T	probably damaging	Het
Map1lc3b	A	G	8: 121,593,577	N43S	probably benign	Het
Map3k21	A	T	8: 125,939,866	D599V	probably benign	Het
Mastl	T	C	2: 23,133,698	N338D	probably benign	Het
Mepe	A	T	5: 104,338,208	R405*	probably null	Het
Mrps30	T	C	13: 118,380,372	E437G	probably benign	Het
Mup15	A	G	4: 61,438,228	V100A	possibly damaging	Het
Olfml1	A	T	7: 107,567,868	I35F	probably damaging	Het
Olfml2a	T	A	2: 38,960,226	Y651*	probably null	Het
Olfr93	T	A	17: 37,151,822	D50V	probably damaging	Het
Otog	T	C	7: 46,298,317	V113A	probably damaging	Het
Parvg	C	T	15: 84,326,263	L44F	possibly damaging	Het
Pcnx2	G	T	8: 125,772,100	D1553E	probably damaging	Het
Pcyt2	C	T	11: 120,614,374	G122S	probably damaging	Het
Pi4ka	A	G	16: 17,376,982	L184P	possibly damaging	Het
Polq	C	T	16: 37,077,148	T2134I	probably damaging	Het
Prkce	T	G	17: 86,630,061	F641V	probably damaging	Het
Prss1	T	C	6: 41,463,720	I243T	possibly damaging	Het
Pxmp2	A	G	5: 110,281,319	F91L	probably benign	Het
Ralgapb	G	A	2: 158,436,566	G5R	probably damaging	Het
Rasgef1a	T	G	6: 118,087,213	M337R	possibly damaging	Het
Rassf2	A	G	2: 132,002,925	M199T	probably damaging	Het
Rtbdn	A	T	8: 84,952,674	Y67F	probably null	Het
Scamp3	T	C	3: 89,181,949	V271A	probably benign	Het
Sema3a	A	T	5: 13,597,616	R613W	possibly damaging	Het
Slc4a3	A	T	1: 75,551,315	I206F	probably damaging	Het
Slc9b1	A	G	3: 135,357,757		probably null	Het
Smchd1	C	A	17: 71,475,101	V22F	probably benign	Het
Smg1	A	G	7: 118,184,571		probably benign	Het
Stab1	A	G	14: 31,139,160	L89P	probably damaging	Het
Stim1	A	G	7: 102,427,291	E152G	probably damaging	Het
Tenm3	A	G	8: 48,674,493	F50S	probably damaging	Het
Tpgs2	T	G	18: 25,129,870	N231H	probably benign	Het
Trank1	T	A	9: 111,390,679	N2161K	probably damaging	Het
Trim28	A	G	7: 13,025,346	D129G	probably benign	Het
Trim66	A	T	7: 109,477,754	I326N	probably damaging	Het
Trim80	A	T	11: 115,448,017	T558S	probably benign	Het
Uggt1	T	A	1: 36,230,688	T83S	probably benign	Het
Wdr91	A	G	6: 34,886,819	I587T	probably damaging	Het
Zpld1	A	T	16: 55,232,240	V337D	possibly damaging	Het

Other mutations in Cep290

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Cep290	APN	10	100508724	missense	probably benign	0.00
IGL00499:Cep290	APN	10	100543327	missense	probably damaging	1.00
IGL00547:Cep290	APN	10	100510708	missense	probably damaging	0.99
IGL00573:Cep290	APN	10	100540361	missense	probably damaging	1.00
IGL00646:Cep290	APN	10	100501154	missense	probably benign	0.15
IGL00755:Cep290	APN	10	100531104	missense	probably damaging	1.00
IGL00835:Cep290	APN	10	100563380	nonsense	probably null
IGL00846:Cep290	APN	10	100540333	splice site	probably benign
IGL00985:Cep290	APN	10	100567161	splice site	probably benign
IGL01687:Cep290	APN	10	100500205	missense	probably damaging	1.00
IGL01782:Cep290	APN	10	100545125	nonsense	probably null
IGL02010:Cep290	APN	10	100508707	missense	probably benign	0.39
IGL02010:Cep290	APN	10	100561345	missense	probably benign	0.00
IGL02036:Cep290	APN	10	100558100	nonsense	probably null
IGL02039:Cep290	APN	10	100514602	critical splice donor site	probably null
IGL02532:Cep290	APN	10	100545065	missense	probably benign	0.04
IGL02950:Cep290	APN	10	100540329	splice site	probably benign
IGL03105:Cep290	APN	10	100551824	missense	possibly damaging	0.66
IGL03179:Cep290	APN	10	100568088	missense	possibly damaging	0.60
IGL03271:Cep290	APN	10	100537801	missense	probably benign	0.09
IGL03401:Cep290	APN	10	100500265	missense	probably benign	0.27
PIT4687001:Cep290	UTSW	10	100537591	missense	probably benign	0.28
R0025:Cep290	UTSW	10	100537831	missense	probably damaging	1.00
R0127:Cep290	UTSW	10	100536925	splice site	probably benign
R0254:Cep290	UTSW	10	100514574	missense	probably benign	0.31
R0295:Cep290	UTSW	10	100537821	missense	probably damaging	0.99
R0371:Cep290	UTSW	10	100518564	splice site	probably benign
R0390:Cep290	UTSW	10	100508758	missense	probably benign	0.09
R0399:Cep290	UTSW	10	100554400	splice site	probably benign
R0413:Cep290	UTSW	10	100523314	nonsense	probably null
R0427:Cep290	UTSW	10	100516179	missense	probably benign	0.01
R0472:Cep290	UTSW	10	100551455	missense	probably benign	0.19
R0485:Cep290	UTSW	10	100549344	missense	possibly damaging	0.94
R0635:Cep290	UTSW	10	100492676	missense	probably damaging	1.00
R0675:Cep290	UTSW	10	100568813	critical splice acceptor site	probably null
R0972:Cep290	UTSW	10	100518762	missense	probably benign	0.08
R1238:Cep290	UTSW	10	100517863	missense	probably damaging	1.00
R1297:Cep290	UTSW	10	100539100	splice site	probably benign
R1368:Cep290	UTSW	10	100494966	splice site	probably benign
R1394:Cep290	UTSW	10	100537529	missense	possibly damaging	0.66
R1437:Cep290	UTSW	10	100572101	missense	probably benign	0.00
R1493:Cep290	UTSW	10	100562181	missense	probably benign	0.21
R1496:Cep290	UTSW	10	100538966	missense	probably damaging	1.00
R1539:Cep290	UTSW	10	100496828	missense	probably benign	0.06
R1598:Cep290	UTSW	10	100549329	missense	probably damaging	1.00
R1616:Cep290	UTSW	10	100568836	missense	probably benign
R1712:Cep290	UTSW	10	100554499	missense	probably benign	0.02
R1753:Cep290	UTSW	10	100513981	missense	probably benign
R1773:Cep290	UTSW	10	100510573	missense	probably benign
R1775:Cep290	UTSW	10	100496810	missense	probably damaging	0.98
R1799:Cep290	UTSW	10	100516196	missense	probably benign	0.00
R1937:Cep290	UTSW	10	100497953	missense	possibly damaging	0.71
R1991:Cep290	UTSW	10	100531184	missense	possibly damaging	0.80
R2031:Cep290	UTSW	10	100512400	critical splice donor site	probably null
R2164:Cep290	UTSW	10	100518795	missense	probably damaging	0.96
R2393:Cep290	UTSW	10	100561238	critical splice acceptor site	probably null
R2403:Cep290	UTSW	10	100537437	missense	probably benign	0.19
R3612:Cep290	UTSW	10	100541581	nonsense	probably null
R3800:Cep290	UTSW	10	100572941	missense	probably damaging	0.97
R4005:Cep290	UTSW	10	100539008	missense	probably damaging	1.00
R4039:Cep290	UTSW	10	100512401	critical splice donor site	probably null
R4259:Cep290	UTSW	10	100514492	missense	probably damaging	1.00
R4260:Cep290	UTSW	10	100514492	missense	probably damaging	1.00
R4319:Cep290	UTSW	10	100539047	missense	probably benign	0.09
R4329:Cep290	UTSW	10	100537668	missense	probably damaging	0.98
R4573:Cep290	UTSW	10	100518850	missense	probably benign
R4614:Cep290	UTSW	10	100508740	missense	probably benign
R4614:Cep290	UTSW	10	100559687	missense	possibly damaging	0.93
R4708:Cep290	UTSW	10	100523264	missense	probably benign	0.02
R4727:Cep290	UTSW	10	100563270	missense	probably benign	0.05
R4825:Cep290	UTSW	10	100488348	missense	probably damaging	0.96
R4839:Cep290	UTSW	10	100508786	missense	probably damaging	0.99
R4858:Cep290	UTSW	10	100494911	missense	probably benign	0.31
R4871:Cep290	UTSW	10	100548914	missense	probably benign	0.22
R5094:Cep290	UTSW	10	100567030	missense	probably damaging	0.97
R5103:Cep290	UTSW	10	100539020	missense	probably damaging	1.00
R5499:Cep290	UTSW	10	100537653	missense	probably damaging	0.99
R5505:Cep290	UTSW	10	100499186	critical splice donor site	probably null
R5615:Cep290	UTSW	10	100531150	missense	probably damaging	1.00
R5815:Cep290	UTSW	10	100558108	missense	possibly damaging	0.80
R5883:Cep290	UTSW	10	100523399	missense	probably benign	0.44
R5889:Cep290	UTSW	10	100499074	missense	possibly damaging	0.95
R5928:Cep290	UTSW	10	100551830	missense	probably damaging	0.99
R5992:Cep290	UTSW	10	100543321	missense	possibly damaging	0.73
R6000:Cep290	UTSW	10	100541787	missense	probably damaging	1.00
R6213:Cep290	UTSW	10	100523360	missense	probably benign	0.06
R6274:Cep290	UTSW	10	100530207	missense	probably damaging	1.00
R6285:Cep290	UTSW	10	100523329	missense	probably benign	0.17
R6306:Cep290	UTSW	10	100531166	missense	possibly damaging	0.89
R6593:Cep290	UTSW	10	100508776	missense	probably benign	0.01
R6649:Cep290	UTSW	10	100518531	missense	probably benign	0.28
R6692:Cep290	UTSW	10	100569144	splice site	probably null
R6847:Cep290	UTSW	10	100563419	missense	probably damaging	1.00
R6947:Cep290	UTSW	10	100530056	missense	probably damaging	1.00
R7035:Cep290	UTSW	10	100499071	missense	probably benign	0.07
R7073:Cep290	UTSW	10	100539003	missense	possibly damaging	0.90
R7114:Cep290	UTSW	10	100543358	missense	probably damaging	0.98
R7256:Cep290	UTSW	10	100546498	missense	probably damaging	1.00
R7258:Cep290	UTSW	10	100499108	missense	probably benign	0.01
R7311:Cep290	UTSW	10	100537718	missense	probably damaging	0.98
R7505:Cep290	UTSW	10	100516265	missense	probably benign	0.01
R7615:Cep290	UTSW	10	100492681	missense	probably benign	0.03
R7643:Cep290	UTSW	10	100537553	missense	probably benign
R7662:Cep290	UTSW	10	100537803	missense	probably benign	0.21
R7663:Cep290	UTSW	10	100554536	critical splice donor site	probably null
R7685:Cep290	UTSW	10	100540057	missense	probably benign	0.19
R7699:Cep290	UTSW	10	100540369	missense	probably benign	0.33
R7717:Cep290	UTSW	10	100492681	missense	probably benign	0.03
R7747:Cep290	UTSW	10	100558176	nonsense	probably null
R7757:Cep290	UTSW	10	100563434	missense	probably benign
R7843:Cep290	UTSW	10	100516188	missense	possibly damaging	0.49
R7905:Cep290	UTSW	10	100554490	missense	probably benign
R8078:Cep290	UTSW	10	100572887	missense	probably benign	0.04
R8081:Cep290	UTSW	10	100558176	nonsense	probably null
R8094:Cep290	UTSW	10	100544931	missense	possibly damaging	0.95
R8266:Cep290	UTSW	10	100559671	missense	probably benign	0.08
R8305:Cep290	UTSW	10	100544934	missense	probably benign	0.09
R8325:Cep290	UTSW	10	100517808	missense	probably benign	0.03
R8372:Cep290	UTSW	10	100549341	missense	probably benign	0.00
R8443:Cep290	UTSW	10	100495844	missense	possibly damaging	0.80
R8497:Cep290	UTSW	10	100551458	missense	probably damaging	1.00
R8778:Cep290	UTSW	10	100514512	nonsense	probably null
R8975:Cep290	UTSW	10	100513920	missense	possibly damaging	0.54
R9146:Cep290	UTSW	10	100541803	missense	probably benign	0.44
R9264:Cep290	UTSW	10	100498016	missense	possibly damaging	0.86
R9374:Cep290	UTSW	10	100536867	missense	probably damaging	0.98
R9448:Cep290	UTSW	10	100559684	missense	probably benign	0.32
R9499:Cep290	UTSW	10	100536867	missense	probably damaging	0.98
R9507:Cep290	UTSW	10	100494923	missense	possibly damaging	0.81
R9539:Cep290	UTSW	10	100568851	missense	probably damaging	1.00
R9547:Cep290	UTSW	10	100544979	missense	probably benign	0.00
R9551:Cep290	UTSW	10	100536867	missense	probably damaging	0.98
R9657:Cep290	UTSW	10	100515141	missense	possibly damaging	0.93
R9731:Cep290	UTSW	10	100510542	missense	probably damaging	0.98
R9756:Cep290	UTSW	10	100516172	missense	probably damaging	0.97
R9777:Cep290	UTSW	10	100518667	missense	probably benign	0.01
Z1176:Cep290	UTSW	10	100549374	critical splice donor site	probably benign
Z1177:Cep290	UTSW	10	100497944	missense	probably benign
Z1177:Cep290	UTSW	10	100538997	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GCCTGATGTACAATGTCATGAATTG -3'
(R):5'- AGTATATCCCAAATTACTGGCCC -3'

Sequencing Primer
(F):5'- TGTCATGAATTGAAATTGCTTCTTG -3'
(R):5'- TGGCCCCAAATATTTTTCTATATGC -3'

Posted On

2018-08-29