Incidental Mutation 'R6788:Dnah12'
ID 532516
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Name dynein, axonemal, heavy chain 12
Synonyms HL19, DHC3, Dnahc7l, 4921531P07Rik, HL-19, LOC380889, Hdhc3, Dnahc12, DLP12
MMRRC Submission 044902-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.187) question?
Stock # R6788 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 26414429-26613660 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 26523470 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 1986 (L1986F)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000022433
AA Change: L1986F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: L1986F

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Meta Mutation Damage Score 0.0939 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.4%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A T 1: 179,580,199 (GRCm39) V2001E probably benign Het
Ahsg A G 16: 22,713,585 (GRCm39) D122G probably benign Het
Ank3 A G 10: 69,840,553 (GRCm39) Y1616C probably damaging Het
Arhgef1 A G 7: 24,619,205 (GRCm39) probably null Het
Atp7b T C 8: 22,494,391 (GRCm39) I1023V probably benign Het
Bod1l A T 5: 41,979,216 (GRCm39) Y699* probably null Het
Car12 C T 9: 66,659,244 (GRCm39) S183L probably damaging Het
Cep290 T C 10: 100,324,490 (GRCm39) S57P probably damaging Het
Cep57l1 T C 10: 41,619,145 (GRCm39) D74G probably damaging Het
Cers6 T C 2: 68,938,903 (GRCm39) Y374H possibly damaging Het
Chmp4c T A 3: 10,432,195 (GRCm39) M35K possibly damaging Het
Crkl G A 16: 17,301,645 (GRCm39) D300N probably damaging Het
Cyp3a41a A G 5: 145,642,639 (GRCm39) M240T probably benign Het
Dipk2a C T 9: 94,406,502 (GRCm39) V302I probably benign Het
Dnah8 T C 17: 30,867,439 (GRCm39) I297T probably benign Het
Dock10 T A 1: 80,508,962 (GRCm39) I1610F probably damaging Het
Dpys T A 15: 39,720,559 (GRCm39) H67L probably damaging Het
Epc2 T G 2: 49,422,099 (GRCm39) V331G probably benign Het
Fnbp1l G A 3: 122,339,956 (GRCm39) R344* probably null Het
Gmip G T 8: 70,263,824 (GRCm39) L89F possibly damaging Het
Gmip G C 8: 70,263,826 (GRCm39) R90P probably damaging Het
Gpi1 A G 7: 33,928,415 (GRCm39) S74P probably damaging Het
Gys1 G A 7: 45,094,102 (GRCm39) E406K probably damaging Het
Hspg2 G A 4: 137,242,618 (GRCm39) G611E probably damaging Het
Klhl29 C T 12: 5,134,393 (GRCm39) V673M probably damaging Het
Lnpk T C 2: 74,360,020 (GRCm39) T332A probably benign Het
Loxl4 T C 19: 42,596,792 (GRCm39) D60G probably damaging Het
Lrr1 T C 12: 69,221,449 (GRCm39) I197T probably damaging Het
Map1lc3b A G 8: 122,320,316 (GRCm39) N43S probably benign Het
Map3k21 A T 8: 126,666,605 (GRCm39) D599V probably benign Het
Mastl T C 2: 23,023,710 (GRCm39) N338D probably benign Het
Mepe A T 5: 104,486,074 (GRCm39) R405* probably null Het
Mrps30 T C 13: 118,516,908 (GRCm39) E437G probably benign Het
Mup15 A G 4: 61,356,465 (GRCm39) V100A possibly damaging Het
Olfml1 A T 7: 107,167,075 (GRCm39) I35F probably damaging Het
Olfml2a T A 2: 38,850,238 (GRCm39) Y651* probably null Het
Or2h1b T A 17: 37,462,713 (GRCm39) D50V probably damaging Het
Otog T C 7: 45,947,741 (GRCm39) V113A probably damaging Het
Parvg C T 15: 84,210,464 (GRCm39) L44F possibly damaging Het
Pcnx2 G T 8: 126,498,839 (GRCm39) D1553E probably damaging Het
Pcyt2 C T 11: 120,505,200 (GRCm39) G122S probably damaging Het
Pi4ka A G 16: 17,194,846 (GRCm39) L184P possibly damaging Het
Polq C T 16: 36,897,510 (GRCm39) T2134I probably damaging Het
Prkce T G 17: 86,937,489 (GRCm39) F641V probably damaging Het
Prss1 T C 6: 41,440,654 (GRCm39) I243T possibly damaging Het
Pxmp2 A G 5: 110,429,185 (GRCm39) F91L probably benign Het
Ralgapb G A 2: 158,278,486 (GRCm39) G5R probably damaging Het
Rasgef1a T G 6: 118,064,174 (GRCm39) M337R possibly damaging Het
Rassf2 A G 2: 131,844,845 (GRCm39) M199T probably damaging Het
Rtbdn A T 8: 85,679,303 (GRCm39) Y67F probably null Het
Scamp3 T C 3: 89,089,256 (GRCm39) V271A probably benign Het
Sema3a A T 5: 13,647,584 (GRCm39) R613W possibly damaging Het
Slc4a3 A T 1: 75,527,959 (GRCm39) I206F probably damaging Het
Slc9b1 A G 3: 135,063,518 (GRCm39) probably null Het
Smchd1 C A 17: 71,782,096 (GRCm39) V22F probably benign Het
Smg1 A G 7: 117,783,794 (GRCm39) probably benign Het
Spaca7b T C 8: 11,728,584 (GRCm39) E29G possibly damaging Het
Spata31e4 A C 13: 50,857,131 (GRCm39) H923P probably damaging Het
Stab1 A G 14: 30,861,117 (GRCm39) L89P probably damaging Het
Stim1 A G 7: 102,076,498 (GRCm39) E152G probably damaging Het
Tenm3 A G 8: 49,127,528 (GRCm39) F50S probably damaging Het
Tpgs2 T G 18: 25,262,927 (GRCm39) N231H probably benign Het
Trank1 T A 9: 111,219,747 (GRCm39) N2161K probably damaging Het
Trim28 A G 7: 12,759,273 (GRCm39) D129G probably benign Het
Trim66 A T 7: 109,076,961 (GRCm39) I326N probably damaging Het
Trim80 A T 11: 115,338,843 (GRCm39) T558S probably benign Het
Uggt1 T A 1: 36,269,769 (GRCm39) T83S probably benign Het
Wdr91 A G 6: 34,863,754 (GRCm39) I587T probably damaging Het
Zpld1 A T 16: 55,052,603 (GRCm39) V337D possibly damaging Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26,492,962 (GRCm39) missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26,431,430 (GRCm39) splice site probably benign
IGL01681:Dnah12 APN 14 26,443,315 (GRCm39) missense probably benign
IGL02082:Dnah12 APN 14 26,428,317 (GRCm39) missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26,437,732 (GRCm39) missense probably benign 0.20
IGL02170:Dnah12 APN 14 26,495,069 (GRCm39) missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26,428,072 (GRCm39) missense probably benign 0.00
IGL02367:Dnah12 APN 14 26,430,316 (GRCm39) missense probably benign 0.30
IGL02418:Dnah12 APN 14 26,495,679 (GRCm39) missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26,445,667 (GRCm39) missense probably benign 0.02
IGL03066:Dnah12 APN 14 26,418,553 (GRCm39) missense probably benign 0.06
drippings UTSW 14 26,576,761 (GRCm39) missense probably damaging 1.00
grueben UTSW 14 26,600,036 (GRCm39) missense probably damaging 1.00
BB010:Dnah12 UTSW 14 26,488,072 (GRCm39) missense probably benign 0.00
BB020:Dnah12 UTSW 14 26,488,072 (GRCm39) missense probably benign 0.00
F5770:Dnah12 UTSW 14 26,495,050 (GRCm39) missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
FR4340:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26,594,697 (GRCm39) missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26,494,601 (GRCm39) missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26,520,856 (GRCm39) missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26,521,956 (GRCm39) missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26,427,272 (GRCm39) splice site probably null
R0364:Dnah12 UTSW 14 26,445,628 (GRCm39) missense probably benign 0.10
R0469:Dnah12 UTSW 14 26,520,856 (GRCm39) missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26,430,465 (GRCm39) missense probably benign 0.00
R0709:Dnah12 UTSW 14 26,606,222 (GRCm39) splice site probably benign
R0734:Dnah12 UTSW 14 26,521,970 (GRCm39) missense probably benign 0.00
R1273:Dnah12 UTSW 14 26,460,375 (GRCm39) nonsense probably null
R1496:Dnah12 UTSW 14 26,431,403 (GRCm39) missense probably benign
R1503:Dnah12 UTSW 14 26,495,649 (GRCm39) missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26,538,279 (GRCm39) missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26,488,147 (GRCm39) missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26,500,840 (GRCm39) missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26,488,071 (GRCm39) missense probably benign 0.02
R1826:Dnah12 UTSW 14 26,432,174 (GRCm39) missense probably benign 0.01
R1829:Dnah12 UTSW 14 26,522,032 (GRCm39) missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26,494,980 (GRCm39) missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26,430,412 (GRCm39) missense probably benign 0.30
R1862:Dnah12 UTSW 14 26,418,553 (GRCm39) missense probably benign 0.06
R1913:Dnah12 UTSW 14 26,514,221 (GRCm39) splice site probably null
R1933:Dnah12 UTSW 14 26,455,650 (GRCm39) missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26,536,416 (GRCm39) missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26,503,485 (GRCm39) missense probably null 1.00
R2113:Dnah12 UTSW 14 26,488,098 (GRCm39) missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26,445,613 (GRCm39) nonsense probably null
R2126:Dnah12 UTSW 14 26,445,613 (GRCm39) nonsense probably null
R2207:Dnah12 UTSW 14 26,503,744 (GRCm39) missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26,460,485 (GRCm39) missense probably benign 0.06
R2511:Dnah12 UTSW 14 26,491,907 (GRCm39) missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26,598,907 (GRCm39) missense probably benign 0.05
R2875:Dnah12 UTSW 14 26,414,625 (GRCm39) missense probably benign 0.04
R3551:Dnah12 UTSW 14 26,492,929 (GRCm39) missense probably benign 0.01
R3713:Dnah12 UTSW 14 26,534,747 (GRCm39) missense probably benign
R3729:Dnah12 UTSW 14 26,427,220 (GRCm39) missense probably benign 0.02
R3799:Dnah12 UTSW 14 26,492,880 (GRCm39) missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26,431,366 (GRCm39) missense probably benign 0.00
R3892:Dnah12 UTSW 14 26,578,573 (GRCm39) missense probably benign 0.03
R3921:Dnah12 UTSW 14 26,493,008 (GRCm39) missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26,444,754 (GRCm39) missense probably benign
R4065:Dnah12 UTSW 14 26,492,405 (GRCm39) missense probably benign 0.02
R4113:Dnah12 UTSW 14 26,414,722 (GRCm39) missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26,430,341 (GRCm39) missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26,520,883 (GRCm39) missense probably benign 0.01
R4260:Dnah12 UTSW 14 26,520,883 (GRCm39) missense probably benign 0.01
R4348:Dnah12 UTSW 14 26,536,498 (GRCm39) missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26,537,464 (GRCm39) missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26,455,758 (GRCm39) missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26,455,758 (GRCm39) missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26,593,812 (GRCm39) missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26,598,915 (GRCm39) missense possibly damaging 0.83
R4523:Dnah12 UTSW 14 26,491,979 (GRCm39) missense probably damaging 0.97
R4546:Dnah12 UTSW 14 26,494,971 (GRCm39) missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26,494,551 (GRCm39) missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26,456,913 (GRCm39) missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26,427,994 (GRCm39) missense probably benign 0.00
R4727:Dnah12 UTSW 14 26,594,274 (GRCm39) missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26,503,741 (GRCm39) missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26,503,741 (GRCm39) missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26,437,784 (GRCm39) nonsense probably null
R4879:Dnah12 UTSW 14 26,439,201 (GRCm39) critical splice donor site probably null
R4893:Dnah12 UTSW 14 26,431,325 (GRCm39) missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26,455,725 (GRCm39) missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26,583,762 (GRCm39) nonsense probably null
R4939:Dnah12 UTSW 14 26,613,481 (GRCm39) missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26,437,855 (GRCm39) missense probably benign 0.00
R5011:Dnah12 UTSW 14 26,431,326 (GRCm39) missense probably benign 0.03
R5013:Dnah12 UTSW 14 26,431,326 (GRCm39) missense probably benign 0.03
R5043:Dnah12 UTSW 14 26,606,147 (GRCm39) missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26,456,852 (GRCm39) missense probably benign 0.09
R5122:Dnah12 UTSW 14 26,439,155 (GRCm39) missense probably benign 0.00
R5135:Dnah12 UTSW 14 26,492,434 (GRCm39) missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26,572,883 (GRCm39) nonsense probably null
R5154:Dnah12 UTSW 14 26,571,320 (GRCm39) missense probably benign 0.12
R5206:Dnah12 UTSW 14 26,491,942 (GRCm39) missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26,414,641 (GRCm39) missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26,495,787 (GRCm39) missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26,601,695 (GRCm39) missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26,536,494 (GRCm39) missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26,496,299 (GRCm39) splice site probably null
R5389:Dnah12 UTSW 14 26,456,904 (GRCm39) missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26,581,256 (GRCm39) missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26,493,007 (GRCm39) missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26,431,424 (GRCm39) missense probably benign 0.01
R5681:Dnah12 UTSW 14 26,537,452 (GRCm39) missense probably benign 0.32
R5824:Dnah12 UTSW 14 26,492,475 (GRCm39) critical splice donor site probably null
R5863:Dnah12 UTSW 14 26,576,878 (GRCm39) missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26,428,039 (GRCm39) missense probably benign 0.09
R5912:Dnah12 UTSW 14 26,491,965 (GRCm39) nonsense probably null
R5916:Dnah12 UTSW 14 26,428,073 (GRCm39) missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26,428,022 (GRCm39) missense probably benign 0.00
R5987:Dnah12 UTSW 14 26,608,828 (GRCm39) missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26,418,496 (GRCm39) missense probably benign 0.04
R6132:Dnah12 UTSW 14 26,439,066 (GRCm39) missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26,597,227 (GRCm39) missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26,495,642 (GRCm39) missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26,583,726 (GRCm39) missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26,431,412 (GRCm39) missense probably benign 0.03
R6235:Dnah12 UTSW 14 26,576,761 (GRCm39) missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26,492,439 (GRCm39) missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26,439,129 (GRCm39) missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26,427,989 (GRCm39) missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26,600,008 (GRCm39) missense probably benign 0.06
R6480:Dnah12 UTSW 14 26,594,412 (GRCm39) missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26,456,865 (GRCm39) missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26,456,847 (GRCm39) missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26,594,706 (GRCm39) missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26,518,180 (GRCm39) missense probably benign 0.02
R6745:Dnah12 UTSW 14 26,428,383 (GRCm39) missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26,456,904 (GRCm39) missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26,600,036 (GRCm39) missense probably damaging 1.00
R6982:Dnah12 UTSW 14 26,521,033 (GRCm39) splice site probably null
R7001:Dnah12 UTSW 14 26,601,681 (GRCm39) missense probably damaging 0.99
R7002:Dnah12 UTSW 14 26,598,955 (GRCm39) missense probably damaging 1.00
R7017:Dnah12 UTSW 14 26,456,835 (GRCm39) missense probably benign
R7107:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7108:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7121:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7122:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7135:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7135:Dnah12 UTSW 14 26,523,370 (GRCm39) missense probably damaging 0.99
R7150:Dnah12 UTSW 14 26,583,689 (GRCm39) missense probably damaging 0.99
R7188:Dnah12 UTSW 14 26,536,370 (GRCm39) missense probably benign 0.04
R7201:Dnah12 UTSW 14 26,536,579 (GRCm39) missense probably benign 0.08
R7202:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7204:Dnah12 UTSW 14 26,503,442 (GRCm39) missense probably damaging 0.99
R7204:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7205:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7206:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7219:Dnah12 UTSW 14 26,576,837 (GRCm39) missense probably damaging 0.99
R7337:Dnah12 UTSW 14 26,488,534 (GRCm39) splice site probably null
R7339:Dnah12 UTSW 14 26,594,277 (GRCm39) missense probably benign
R7363:Dnah12 UTSW 14 26,445,766 (GRCm39) missense probably benign
R7426:Dnah12 UTSW 14 26,445,781 (GRCm39) missense probably benign 0.01
R7472:Dnah12 UTSW 14 26,578,592 (GRCm39) missense probably benign 0.01
R7579:Dnah12 UTSW 14 26,492,460 (GRCm39) missense probably benign 0.05
R7655:Dnah12 UTSW 14 26,581,273 (GRCm39) missense probably benign 0.21
R7656:Dnah12 UTSW 14 26,581,273 (GRCm39) missense probably benign 0.21
R7694:Dnah12 UTSW 14 26,503,337 (GRCm39) missense probably damaging 1.00
R7730:Dnah12 UTSW 14 26,507,890 (GRCm39) missense probably damaging 1.00
R7837:Dnah12 UTSW 14 26,518,176 (GRCm39) missense probably benign 0.01
R7855:Dnah12 UTSW 14 26,551,286 (GRCm39) missense probably benign 0.14
R7870:Dnah12 UTSW 14 26,578,486 (GRCm39) missense probably benign 0.00
R7920:Dnah12 UTSW 14 26,578,499 (GRCm39) missense possibly damaging 0.58
R7933:Dnah12 UTSW 14 26,488,072 (GRCm39) missense probably benign 0.00
R7956:Dnah12 UTSW 14 26,430,427 (GRCm39) missense probably damaging 0.96
R8192:Dnah12 UTSW 14 26,428,036 (GRCm39) missense probably benign
R8263:Dnah12 UTSW 14 26,613,421 (GRCm39) missense noncoding transcript
R8287:Dnah12 UTSW 14 26,534,560 (GRCm39) missense probably benign
R8336:Dnah12 UTSW 14 26,432,220 (GRCm39) missense probably benign 0.01
R8362:Dnah12 UTSW 14 26,576,788 (GRCm39) missense probably damaging 1.00
R8392:Dnah12 UTSW 14 26,607,869 (GRCm39) missense probably benign
R8458:Dnah12 UTSW 14 26,548,849 (GRCm39) critical splice acceptor site probably null
R8481:Dnah12 UTSW 14 26,575,753 (GRCm39) missense probably benign 0.02
R8551:Dnah12 UTSW 14 26,496,227 (GRCm39) missense probably damaging 0.97
R8669:Dnah12 UTSW 14 26,552,582 (GRCm39) splice site probably benign
R8698:Dnah12 UTSW 14 26,428,418 (GRCm39) missense probably benign 0.02
R8709:Dnah12 UTSW 14 26,414,757 (GRCm39) missense probably benign 0.00
R8778:Dnah12 UTSW 14 26,455,718 (GRCm39) missense probably benign 0.29
R9049:Dnah12 UTSW 14 26,443,275 (GRCm39) missense probably benign 0.00
R9087:Dnah12 UTSW 14 26,546,503 (GRCm39) missense probably damaging 1.00
R9099:Dnah12 UTSW 14 26,492,325 (GRCm39) missense probably benign 0.31
R9153:Dnah12 UTSW 14 26,536,569 (GRCm39) missense probably damaging 1.00
R9177:Dnah12 UTSW 14 26,571,255 (GRCm39) missense possibly damaging 0.84
R9214:Dnah12 UTSW 14 26,445,060 (GRCm39) missense probably benign 0.02
R9268:Dnah12 UTSW 14 26,571,255 (GRCm39) missense possibly damaging 0.84
R9274:Dnah12 UTSW 14 26,537,374 (GRCm39) missense probably benign 0.00
R9293:Dnah12 UTSW 14 26,495,016 (GRCm39) missense probably benign
R9322:Dnah12 UTSW 14 26,492,934 (GRCm39) missense possibly damaging 0.75
R9353:Dnah12 UTSW 14 26,578,507 (GRCm39) missense probably damaging 1.00
R9506:Dnah12 UTSW 14 26,514,168 (GRCm39) missense probably benign 0.00
R9518:Dnah12 UTSW 14 26,495,713 (GRCm39) missense probably damaging 1.00
R9524:Dnah12 UTSW 14 26,572,494 (GRCm39) missense probably null 0.91
R9562:Dnah12 UTSW 14 26,597,281 (GRCm39) missense possibly damaging 0.58
R9565:Dnah12 UTSW 14 26,597,281 (GRCm39) missense possibly damaging 0.58
R9573:Dnah12 UTSW 14 26,414,619 (GRCm39) missense probably benign
R9581:Dnah12 UTSW 14 26,491,985 (GRCm39) missense probably damaging 1.00
R9689:Dnah12 UTSW 14 26,590,871 (GRCm39) missense probably null 1.00
R9727:Dnah12 UTSW 14 26,523,510 (GRCm39) nonsense probably null
V7580:Dnah12 UTSW 14 26,495,050 (GRCm39) missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26,495,050 (GRCm39) missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26,536,437 (GRCm39) missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26,538,245 (GRCm39) missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26,536,602 (GRCm39) missense possibly damaging 0.93
Z1177:Dnah12 UTSW 14 26,597,172 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTAGCTGCTACTGCTAATC -3'
(R):5'- CCATCAGACCAATAATCACTTTCTG -3'

Sequencing Primer
(F):5'- AGCTGCTACTGCTAATCTGTGGATAC -3'
(R):5'- GATATGACTTTAGCATGGCT -3'
Posted On 2018-08-29