Incidental Mutation 'R6790:Ugt8a'
ID532542
Institutional Source Beutler Lab
Gene Symbol Ugt8a
Ensembl Gene ENSMUSG00000032854
Gene NameUDP galactosyltransferase 8A
SynonymsmCerGT, Cgt, Ugt8
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.682) question?
Stock #R6790 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location125865271-125938619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125871691 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 386 (T386A)
Ref Sequence ENSEMBL: ENSMUSP00000143605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057944] [ENSMUST00000198610]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057944
AA Change: T386A

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050852
Gene: ENSMUSG00000032854
AA Change: T386A

DomainStartEndE-ValueType
Pfam:UDPGT 21 510 4.2e-121 PFAM
Pfam:Glyco_tran_28_C 326 437 6.4e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000198610
AA Change: T386A

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143605
Gene: ENSMUSG00000032854
AA Change: T386A

DomainStartEndE-ValueType
Pfam:UDPGT 21 510 4.2e-121 PFAM
Pfam:Glyco_tran_28_C 326 437 6.4e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UDP-glycosyltransferase family. It catalyzes the transfer of galactose to ceramide, a key enzymatic step in the biosynthesis of galactocerebrosides, which are abundant sphingolipids of the myelin membrane of the central and peripheral nervous systems. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutants fail to make galactolipid galactocerebroside and its sulfated derivative that are normal myelin constituents. Mutants have tremors, ataxia, progressive hindlimb paralysis and vacuole formation in ventral spinal cord due to abnormal myelin sheath. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,323 T247A probably benign Het
4930467E23Rik A T 8: 19,729,785 I14F probably benign Het
9230113P08Rik G T 9: 35,908,831 probably benign Het
Acap3 T A 4: 155,902,991 S457T probably damaging Het
Adgrf3 A G 5: 30,196,387 V881A probably benign Het
Ankrd65 T G 4: 155,792,803 probably null Het
Ascc3 A G 10: 50,645,712 E441G probably damaging Het
Atf5 A T 7: 44,813,255 probably null Het
Cfap97 G T 8: 46,170,076 V168L possibly damaging Het
Crh T G 3: 19,694,295 E61A probably damaging Het
Cx3cr1 C T 9: 120,051,767 V190M probably damaging Het
Cyp3a59 A C 5: 146,096,333 M172L probably benign Het
Dnm1 T C 2: 32,333,067 K445R probably damaging Het
Eng C A 2: 32,669,445 T82N probably damaging Het
Fkbp15 T C 4: 62,304,759 T968A probably benign Het
Fsip2 A G 2: 82,990,939 N5672S possibly damaging Het
Gm21149 A C 5: 15,472,105 D250E unknown Het
Gon4l A G 3: 88,858,998 E448G probably damaging Het
Hrnr T C 3: 93,329,075 S2207P unknown Het
Itga4 C A 2: 79,325,614 H975N probably benign Het
Kdm4c A G 4: 74,391,461 K954E probably damaging Het
Lrrc20 G T 10: 61,527,119 V48F probably damaging Het
Mga A G 2: 119,923,754 I915V probably damaging Het
Npc1l1 C T 11: 6,214,260 probably null Het
Olfr401 T A 11: 74,121,601 L104H probably damaging Het
Per2 C T 1: 91,445,539 V176I probably benign Het
Pira2 A C 7: 3,842,443 V314G probably damaging Het
Rims1 T C 1: 22,468,197 D624G probably damaging Het
Secisbp2 A G 13: 51,670,903 T396A probably benign Het
Slc28a3 T C 13: 58,582,650 D84G probably benign Het
Slc8a3 T C 12: 81,314,432 T538A probably benign Het
Slk T A 19: 47,635,568 C991S probably damaging Het
Stmn1 T C 4: 134,470,814 L54S probably damaging Het
Tuft1 C G 3: 94,628,230 E128D possibly damaging Het
Zdhhc20 A G 14: 57,890,143 V13A probably benign Het
Other mutations in Ugt8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ugt8a APN 3 125914636 critical splice donor site probably null
IGL01934:Ugt8a APN 3 125914775 missense probably benign 0.18
IGL02435:Ugt8a APN 3 125867320 missense probably benign 0.00
IGL03050:Ugt8a UTSW 3 125875490 missense possibly damaging 0.63
R0041:Ugt8a UTSW 3 125915090 missense probably benign 0.00
R0453:Ugt8a UTSW 3 125914957 missense probably benign 0.03
R1314:Ugt8a UTSW 3 125871748 missense probably benign 0.00
R1544:Ugt8a UTSW 3 125915449 missense probably benign 0.06
R1566:Ugt8a UTSW 3 125875558 missense probably damaging 0.96
R1770:Ugt8a UTSW 3 125874203 missense probably benign 0.11
R2126:Ugt8a UTSW 3 125875546 missense probably damaging 0.98
R2972:Ugt8a UTSW 3 125915308 missense probably benign
R2973:Ugt8a UTSW 3 125915308 missense probably benign
R3547:Ugt8a UTSW 3 125867382 nonsense probably null
R3906:Ugt8a UTSW 3 125914982 missense possibly damaging 0.95
R3907:Ugt8a UTSW 3 125914982 missense possibly damaging 0.95
R4032:Ugt8a UTSW 3 125874158 missense probably damaging 1.00
R5235:Ugt8a UTSW 3 125867480 missense probably damaging 1.00
R5890:Ugt8a UTSW 3 125875553 missense probably benign 0.01
R6937:Ugt8a UTSW 3 125915601 start gained probably benign
R7298:Ugt8a UTSW 3 125915416 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AGCATGTATGTGAGCAAATGTG -3'
(R):5'- CAGCCCCATTGACTAGAAGG -3'

Sequencing Primer
(F):5'- ACTTTCACCAGGGCATCA -3'
(R):5'- GTGAAATTTGTGCTTTAGAGAATGCC -3'
Posted On2018-08-29