Incidental Mutation 'R6790:Cyp3a59'
ID532549
Institutional Source Beutler Lab
Gene Symbol Cyp3a59
Ensembl Gene ENSMUSG00000061292
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 59
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6790 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location146079257-146113287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 146096333 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 172 (M172L)
Ref Sequence ENSEMBL: ENSMUSP00000049494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035571] [ENSMUST00000199212]
Predicted Effect probably benign
Transcript: ENSMUST00000035571
AA Change: M172L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049494
Gene: ENSMUSG00000061292
AA Change: M172L

DomainStartEndE-ValueType
Pfam:p450 38 493 5.3e-128 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199212
SMART Domains Protein: ENSMUSP00000142591
Gene: ENSMUSG00000061292

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:p450 38 148 3.3e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,323 T247A probably benign Het
4930467E23Rik A T 8: 19,729,785 I14F probably benign Het
9230113P08Rik G T 9: 35,908,831 probably benign Het
Acap3 T A 4: 155,902,991 S457T probably damaging Het
Adgrf3 A G 5: 30,196,387 V881A probably benign Het
Ankrd65 T G 4: 155,792,803 probably null Het
Ascc3 A G 10: 50,645,712 E441G probably damaging Het
Atf5 A T 7: 44,813,255 probably null Het
Cfap97 G T 8: 46,170,076 V168L possibly damaging Het
Crh T G 3: 19,694,295 E61A probably damaging Het
Cx3cr1 C T 9: 120,051,767 V190M probably damaging Het
Dnm1 T C 2: 32,333,067 K445R probably damaging Het
Eng C A 2: 32,669,445 T82N probably damaging Het
Fkbp15 T C 4: 62,304,759 T968A probably benign Het
Fsip2 A G 2: 82,990,939 N5672S possibly damaging Het
Gm21149 A C 5: 15,472,105 D250E unknown Het
Gon4l A G 3: 88,858,998 E448G probably damaging Het
Hrnr T C 3: 93,329,075 S2207P unknown Het
Itga4 C A 2: 79,325,614 H975N probably benign Het
Kdm4c A G 4: 74,391,461 K954E probably damaging Het
Lrrc20 G T 10: 61,527,119 V48F probably damaging Het
Mga A G 2: 119,923,754 I915V probably damaging Het
Npc1l1 C T 11: 6,214,260 probably null Het
Olfr401 T A 11: 74,121,601 L104H probably damaging Het
Per2 C T 1: 91,445,539 V176I probably benign Het
Pira2 A C 7: 3,842,443 V314G probably damaging Het
Rims1 T C 1: 22,468,197 D624G probably damaging Het
Secisbp2 A G 13: 51,670,903 T396A probably benign Het
Slc28a3 T C 13: 58,582,650 D84G probably benign Het
Slc8a3 T C 12: 81,314,432 T538A probably benign Het
Slk T A 19: 47,635,568 C991S probably damaging Het
Stmn1 T C 4: 134,470,814 L54S probably damaging Het
Tuft1 C G 3: 94,628,230 E128D possibly damaging Het
Ugt8a T C 3: 125,871,691 T386A possibly damaging Het
Zdhhc20 A G 14: 57,890,143 V13A probably benign Het
Other mutations in Cyp3a59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Cyp3a59 APN 5 146102861 missense probably damaging 0.99
IGL01129:Cyp3a59 APN 5 146098279 missense probably benign 0.06
IGL01628:Cyp3a59 APN 5 146099819 missense possibly damaging 0.94
IGL01982:Cyp3a59 APN 5 146104735 missense probably benign 0.00
IGL02094:Cyp3a59 APN 5 146104821 missense probably benign 0.05
IGL02140:Cyp3a59 APN 5 146102880 missense probably damaging 1.00
IGL02350:Cyp3a59 APN 5 146079342 missense probably damaging 1.00
IGL02357:Cyp3a59 APN 5 146079342 missense probably damaging 1.00
IGL02445:Cyp3a59 APN 5 146096653 missense probably benign 0.00
IGL02681:Cyp3a59 APN 5 146090746 splice site probably benign
IGL02870:Cyp3a59 APN 5 146098184 missense probably benign
IGL03023:Cyp3a59 APN 5 146085850 missense probably benign 0.02
PIT4802001:Cyp3a59 UTSW 5 146102801 missense probably benign 0.00
R0220:Cyp3a59 UTSW 5 146098270 missense probably benign 0.02
R0532:Cyp3a59 UTSW 5 146096653 nonsense probably null
R1084:Cyp3a59 UTSW 5 146096674 missense probably benign
R1263:Cyp3a59 UTSW 5 146104711 missense probably damaging 1.00
R1573:Cyp3a59 UTSW 5 146102874 missense probably damaging 1.00
R1747:Cyp3a59 UTSW 5 146104758 missense probably benign
R1759:Cyp3a59 UTSW 5 146098250 missense probably benign 0.10
R1812:Cyp3a59 UTSW 5 146102811 missense probably damaging 1.00
R1937:Cyp3a59 UTSW 5 146094377 missense possibly damaging 0.80
R2026:Cyp3a59 UTSW 5 146096288 missense probably damaging 1.00
R2060:Cyp3a59 UTSW 5 146104714 missense probably damaging 1.00
R2355:Cyp3a59 UTSW 5 146099812 missense probably benign 0.09
R3721:Cyp3a59 UTSW 5 146096597 missense probably damaging 0.96
R4013:Cyp3a59 UTSW 5 146079383 missense probably benign 0.01
R4421:Cyp3a59 UTSW 5 146104903 splice site probably null
R4432:Cyp3a59 UTSW 5 146104786 missense probably benign 0.04
R4633:Cyp3a59 UTSW 5 146094438 missense probably damaging 1.00
R4843:Cyp3a59 UTSW 5 146096261 missense possibly damaging 0.61
R4886:Cyp3a59 UTSW 5 146087387 missense probably damaging 1.00
R5236:Cyp3a59 UTSW 5 146102825 missense probably benign 0.20
R5386:Cyp3a59 UTSW 5 146085768 missense probably benign 0.01
R5627:Cyp3a59 UTSW 5 146112854 missense probably benign 0.00
R5792:Cyp3a59 UTSW 5 146099851 missense possibly damaging 0.92
R5935:Cyp3a59 UTSW 5 146090645 nonsense probably null
R6531:Cyp3a59 UTSW 5 146098217 missense probably benign 0.00
R7108:Cyp3a59 UTSW 5 146096333 missense probably benign
R7222:Cyp3a59 UTSW 5 146096575 critical splice acceptor site probably null
R7447:Cyp3a59 UTSW 5 146087405 missense probably benign 0.25
R7457:Cyp3a59 UTSW 5 146104750 missense probably damaging 1.00
R7723:Cyp3a59 UTSW 5 146079344 missense probably benign 0.06
Z1088:Cyp3a59 UTSW 5 146098222 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CTTAAGAGCAGCATGGGGAA -3'
(R):5'- GAGCCACAGAGTCAGAATTACA -3'

Sequencing Primer
(F):5'- GCTGCATTGAATCAGTCAGC -3'
(R):5'- ACAAGATCATCAGTGGTGTCC -3'
Posted On2018-08-29