Incidental Mutation 'R6790:Npc1l1'
ID532559
Institutional Source Beutler Lab
Gene Symbol Npc1l1
Ensembl Gene ENSMUSG00000020447
Gene NameNPC1 like intracellular cholesterol transporter 1
Synonyms9130221N23Rik, Niemann-Pick disease, type C1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6790 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location6211013-6230143 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 6214260 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000004505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004505]
Predicted Effect probably null
Transcript: ENSMUST00000004505
SMART Domains Protein: ENSMUSP00000004505
Gene: ENSMUSG00000020447

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:NPC1_N 28 283 8.7e-74 PFAM
low complexity region 294 307 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:Patched 385 897 4.7e-52 PFAM
Pfam:Sterol-sensing 661 815 5.7e-55 PFAM
Pfam:MMPL 665 830 2.3e-11 PFAM
Pfam:Patched 1063 1268 6.2e-34 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a multi-pass membrane protein. It contains a conserved N-terminal Niemann-Pick C1 (NPC1) domain and a putative sterol-sensing domain (SSD) which includes a YQRL motif functioning as a plasma membrane to trans-Golgi network transport signal in other proteins. This protein takes up free cholesterol into cells through vesicular endocytosis and plays a critical role in the absorption of intestinal cholesterol. It also has the ability to transport alpha-tocopherol (vitamin E). The drug ezetimibe targets this protein and inhibits the absorption of intestinal cholesterol and alpha-tocopherol. In addition, this protein may play a critical role in regulating lipid metabolism. Polymorphic variations in this gene are associated with plasma total cholesterol and low-density lipoprotein cholesterol (LDL-C) levels and coronary heart disease (CHD) risk. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit normal intestinal development, fertility and plasma cholesterol and triglyceride levels; however, intestinal cholesterol absorption was substantially reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,323 T247A probably benign Het
4930467E23Rik A T 8: 19,729,785 I14F probably benign Het
9230113P08Rik G T 9: 35,908,831 probably benign Het
Acap3 T A 4: 155,902,991 S457T probably damaging Het
Adgrf3 A G 5: 30,196,387 V881A probably benign Het
Ankrd65 T G 4: 155,792,803 probably null Het
Ascc3 A G 10: 50,645,712 E441G probably damaging Het
Atf5 A T 7: 44,813,255 probably null Het
Cfap97 G T 8: 46,170,076 V168L possibly damaging Het
Crh T G 3: 19,694,295 E61A probably damaging Het
Cx3cr1 C T 9: 120,051,767 V190M probably damaging Het
Cyp3a59 A C 5: 146,096,333 M172L probably benign Het
Dnm1 T C 2: 32,333,067 K445R probably damaging Het
Eng C A 2: 32,669,445 T82N probably damaging Het
Fkbp15 T C 4: 62,304,759 T968A probably benign Het
Fsip2 A G 2: 82,990,939 N5672S possibly damaging Het
Gm21149 A C 5: 15,472,105 D250E unknown Het
Gon4l A G 3: 88,858,998 E448G probably damaging Het
Hrnr T C 3: 93,329,075 S2207P unknown Het
Itga4 C A 2: 79,325,614 H975N probably benign Het
Kdm4c A G 4: 74,391,461 K954E probably damaging Het
Lrrc20 G T 10: 61,527,119 V48F probably damaging Het
Mga A G 2: 119,923,754 I915V probably damaging Het
Olfr401 T A 11: 74,121,601 L104H probably damaging Het
Per2 C T 1: 91,445,539 V176I probably benign Het
Pira2 A C 7: 3,842,443 V314G probably damaging Het
Rims1 T C 1: 22,468,197 D624G probably damaging Het
Secisbp2 A G 13: 51,670,903 T396A probably benign Het
Slc28a3 T C 13: 58,582,650 D84G probably benign Het
Slc8a3 T C 12: 81,314,432 T538A probably benign Het
Slk T A 19: 47,635,568 C991S probably damaging Het
Stmn1 T C 4: 134,470,814 L54S probably damaging Het
Tuft1 C G 3: 94,628,230 E128D possibly damaging Het
Ugt8a T C 3: 125,871,691 T386A possibly damaging Het
Zdhhc20 A G 14: 57,890,143 V13A probably benign Het
Other mutations in Npc1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Npc1l1 APN 11 6224199 missense probably damaging 1.00
IGL01348:Npc1l1 APN 11 6227974 missense probably damaging 1.00
IGL01891:Npc1l1 APN 11 6214280 missense probably damaging 1.00
IGL01897:Npc1l1 APN 11 6227879 missense probably benign
IGL02098:Npc1l1 APN 11 6214581 missense probably damaging 0.99
IGL02121:Npc1l1 APN 11 6228157 missense probably benign
IGL02724:Npc1l1 APN 11 6214684 missense possibly damaging 0.88
IGL02947:Npc1l1 APN 11 6229246 missense probably benign 0.01
IGL03328:Npc1l1 APN 11 6218643 nonsense probably null
R0137:Npc1l1 UTSW 11 6228148 nonsense probably null
R0322:Npc1l1 UTSW 11 6229042 missense probably benign
R0352:Npc1l1 UTSW 11 6223076 missense probably benign 0.00
R0492:Npc1l1 UTSW 11 6223040 missense possibly damaging 0.82
R0918:Npc1l1 UTSW 11 6218239 missense probably damaging 1.00
R1300:Npc1l1 UTSW 11 6227859 missense probably damaging 1.00
R1455:Npc1l1 UTSW 11 6228174 missense possibly damaging 0.66
R1588:Npc1l1 UTSW 11 6217785 missense probably benign 0.01
R1803:Npc1l1 UTSW 11 6228846 missense probably damaging 1.00
R1882:Npc1l1 UTSW 11 6217473 splice site probably null
R1944:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6225199 nonsense probably null
R3155:Npc1l1 UTSW 11 6221840 missense probably benign
R4343:Npc1l1 UTSW 11 6217773 missense probably benign
R4504:Npc1l1 UTSW 11 6228741 missense possibly damaging 0.61
R4610:Npc1l1 UTSW 11 6228215 missense probably damaging 1.00
R4807:Npc1l1 UTSW 11 6218723 missense probably damaging 1.00
R4829:Npc1l1 UTSW 11 6214010 critical splice donor site probably null
R5135:Npc1l1 UTSW 11 6224245 missense possibly damaging 0.94
R5290:Npc1l1 UTSW 11 6222221 missense probably benign 0.00
R5369:Npc1l1 UTSW 11 6217705 critical splice donor site probably null
R5388:Npc1l1 UTSW 11 6214733 missense probably damaging 1.00
R5532:Npc1l1 UTSW 11 6224245 missense probably damaging 0.98
R5540:Npc1l1 UTSW 11 6214546 missense probably damaging 1.00
R5754:Npc1l1 UTSW 11 6227839 missense probably damaging 1.00
R5760:Npc1l1 UTSW 11 6229031 missense probably benign 0.02
R6057:Npc1l1 UTSW 11 6217806 missense possibly damaging 0.66
R6388:Npc1l1 UTSW 11 6224145 missense probably damaging 1.00
R6644:Npc1l1 UTSW 11 6214013 missense probably damaging 1.00
R6644:Npc1l1 UTSW 11 6214014 missense probably damaging 0.98
R6756:Npc1l1 UTSW 11 6215153 missense probably damaging 1.00
R7006:Npc1l1 UTSW 11 6217731 missense probably benign
R7062:Npc1l1 UTSW 11 6217807 missense probably benign
R7273:Npc1l1 UTSW 11 6218320 missense probably damaging 1.00
R7383:Npc1l1 UTSW 11 6217777 missense probably benign 0.30
X0022:Npc1l1 UTSW 11 6228058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCCAGCAAGGTGATCAG -3'
(R):5'- AGAATCTAGACATCCGGCTGG -3'

Sequencing Primer
(F):5'- CAGCAAGGTGATCAGGAGGTTG -3'
(R):5'- TAGACATCCGGCTGGCTTGC -3'
Posted On2018-08-29