Mutagenetix > Incidental Mutations

Incidental Mutation 'R6790:Npc1l1'

532559

Institutional Source

Beutler Lab

Gene Symbol

Npc1l1

Ensembl Gene

ENSMUSG00000020447

Gene Name

NPC1 like intracellular cholesterol transporter 1

Synonyms

9130221N23Rik, Niemann-Pick disease, type C1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R6790 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

6211013-6230143 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 6214260 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000004505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004505]

Predicted Effect

probably null
Transcript: ENSMUST00000004505

SMART Domains

Protein: ENSMUSP00000004505
Gene: ENSMUSG00000020447

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:NPC1_N	28	283	8.7e-74	PFAM
low complexity region	294	307	N/A	INTRINSIC
transmembrane domain	348	370	N/A	INTRINSIC
Pfam:Patched	385	897	4.7e-52	PFAM
Pfam:Sterol-sensing	661	815	5.7e-55	PFAM
Pfam:MMPL	665	830	2.3e-11	PFAM
Pfam:Patched	1063	1268	6.2e-34	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a multi-pass membrane protein. It contains a conserved N-terminal Niemann-Pick C1 (NPC1) domain and a putative sterol-sensing domain (SSD) which includes a YQRL motif functioning as a plasma membrane to trans-Golgi network transport signal in other proteins. This protein takes up free cholesterol into cells through vesicular endocytosis and plays a critical role in the absorption of intestinal cholesterol. It also has the ability to transport alpha-tocopherol (vitamin E). The drug ezetimibe targets this protein and inhibits the absorption of intestinal cholesterol and alpha-tocopherol. In addition, this protein may play a critical role in regulating lipid metabolism. Polymorphic variations in this gene are associated with plasma total cholesterol and low-density lipoprotein cholesterol (LDL-C) levels and coronary heart disease (CHD) risk. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit normal intestinal development, fertility and plasma cholesterol and triglyceride levels; however, intestinal cholesterol absorption was substantially reduced. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	T	C	6: 96,165,323	T247A	probably benign	Het
4930467E23Rik	A	T	8: 19,729,785	I14F	probably benign	Het
9230113P08Rik	G	T	9: 35,908,831		probably benign	Het
Acap3	T	A	4: 155,902,991	S457T	probably damaging	Het
Adgrf3	A	G	5: 30,196,387	V881A	probably benign	Het
Ankrd65	T	G	4: 155,792,803		probably null	Het
Ascc3	A	G	10: 50,645,712	E441G	probably damaging	Het
Atf5	A	T	7: 44,813,255		probably null	Het
Cfap97	G	T	8: 46,170,076	V168L	possibly damaging	Het
Crh	T	G	3: 19,694,295	E61A	probably damaging	Het
Cx3cr1	C	T	9: 120,051,767	V190M	probably damaging	Het
Cyp3a59	A	C	5: 146,096,333	M172L	probably benign	Het
Dnm1	T	C	2: 32,333,067	K445R	probably damaging	Het
Eng	C	A	2: 32,669,445	T82N	probably damaging	Het
Fkbp15	T	C	4: 62,304,759	T968A	probably benign	Het
Fsip2	A	G	2: 82,990,939	N5672S	possibly damaging	Het
Gm21149	A	C	5: 15,472,105	D250E	unknown	Het
Gon4l	A	G	3: 88,858,998	E448G	probably damaging	Het
Hrnr	T	C	3: 93,329,075	S2207P	unknown	Het
Itga4	C	A	2: 79,325,614	H975N	probably benign	Het
Kdm4c	A	G	4: 74,391,461	K954E	probably damaging	Het
Lrrc20	G	T	10: 61,527,119	V48F	probably damaging	Het
Mga	A	G	2: 119,923,754	I915V	probably damaging	Het
Olfr401	T	A	11: 74,121,601	L104H	probably damaging	Het
Per2	C	T	1: 91,445,539	V176I	probably benign	Het
Pira2	A	C	7: 3,842,443	V314G	probably damaging	Het
Rims1	T	C	1: 22,468,197	D624G	probably damaging	Het
Secisbp2	A	G	13: 51,670,903	T396A	probably benign	Het
Slc28a3	T	C	13: 58,582,650	D84G	probably benign	Het
Slc8a3	T	C	12: 81,314,432	T538A	probably benign	Het
Slk	T	A	19: 47,635,568	C991S	probably damaging	Het
Stmn1	T	C	4: 134,470,814	L54S	probably damaging	Het
Tuft1	C	G	3: 94,628,230	E128D	possibly damaging	Het
Ugt8a	T	C	3: 125,871,691	T386A	possibly damaging	Het
Zdhhc20	A	G	14: 57,890,143	V13A	probably benign	Het

Other mutations in Npc1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Npc1l1	APN	11	6224199	missense	probably damaging	1.00
IGL01348:Npc1l1	APN	11	6227974	missense	probably damaging	1.00
IGL01891:Npc1l1	APN	11	6214280	missense	probably damaging	1.00
IGL01897:Npc1l1	APN	11	6227879	missense	probably benign
IGL02098:Npc1l1	APN	11	6214581	missense	probably damaging	0.99
IGL02121:Npc1l1	APN	11	6228157	missense	probably benign
IGL02724:Npc1l1	APN	11	6214684	missense	possibly damaging	0.88
IGL02947:Npc1l1	APN	11	6229246	missense	probably benign	0.01
IGL03328:Npc1l1	APN	11	6218643	nonsense	probably null
R0137:Npc1l1	UTSW	11	6228148	nonsense	probably null
R0322:Npc1l1	UTSW	11	6229042	missense	probably benign
R0352:Npc1l1	UTSW	11	6223076	missense	probably benign	0.00
R0492:Npc1l1	UTSW	11	6223040	missense	possibly damaging	0.82
R0918:Npc1l1	UTSW	11	6218239	missense	probably damaging	1.00
R1300:Npc1l1	UTSW	11	6227859	missense	probably damaging	1.00
R1455:Npc1l1	UTSW	11	6228174	missense	possibly damaging	0.66
R1588:Npc1l1	UTSW	11	6217785	missense	probably benign	0.01
R1803:Npc1l1	UTSW	11	6228846	missense	probably damaging	1.00
R1882:Npc1l1	UTSW	11	6217473	splice site	probably null
R1944:Npc1l1	UTSW	11	6214588	missense	possibly damaging	0.67
R1945:Npc1l1	UTSW	11	6214588	missense	possibly damaging	0.67
R1945:Npc1l1	UTSW	11	6225199	nonsense	probably null
R3155:Npc1l1	UTSW	11	6221840	missense	probably benign
R4343:Npc1l1	UTSW	11	6217773	missense	probably benign
R4504:Npc1l1	UTSW	11	6228741	missense	possibly damaging	0.61
R4610:Npc1l1	UTSW	11	6228215	missense	probably damaging	1.00
R4807:Npc1l1	UTSW	11	6218723	missense	probably damaging	1.00
R4829:Npc1l1	UTSW	11	6214010	critical splice donor site	probably null
R5135:Npc1l1	UTSW	11	6224245	missense	possibly damaging	0.94
R5290:Npc1l1	UTSW	11	6222221	missense	probably benign	0.00
R5369:Npc1l1	UTSW	11	6217705	critical splice donor site	probably null
R5388:Npc1l1	UTSW	11	6214733	missense	probably damaging	1.00
R5532:Npc1l1	UTSW	11	6224245	missense	probably damaging	0.98
R5540:Npc1l1	UTSW	11	6214546	missense	probably damaging	1.00
R5754:Npc1l1	UTSW	11	6227839	missense	probably damaging	1.00
R5760:Npc1l1	UTSW	11	6229031	missense	probably benign	0.02
R6057:Npc1l1	UTSW	11	6217806	missense	possibly damaging	0.66
R6388:Npc1l1	UTSW	11	6224145	missense	probably damaging	1.00
R6644:Npc1l1	UTSW	11	6214013	missense	probably damaging	1.00
R6644:Npc1l1	UTSW	11	6214014	missense	probably damaging	0.98
R6756:Npc1l1	UTSW	11	6215153	missense	probably damaging	1.00
R7006:Npc1l1	UTSW	11	6217731	missense	probably benign
R7062:Npc1l1	UTSW	11	6217807	missense	probably benign
R7273:Npc1l1	UTSW	11	6218320	missense	probably damaging	1.00
R7383:Npc1l1	UTSW	11	6217777	missense	probably benign	0.30
X0022:Npc1l1	UTSW	11	6228058	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACCCAGCAAGGTGATCAG -3'
(R):5'- AGAATCTAGACATCCGGCTGG -3'

Sequencing Primer
(F):5'- CAGCAAGGTGATCAGGAGGTTG -3'
(R):5'- TAGACATCCGGCTGGCTTGC -3'

Posted On

2018-08-29