Incidental Mutation 'R6791:Col15a1'
ID532573
Institutional Source Beutler Lab
Gene Symbol Col15a1
Ensembl Gene ENSMUSG00000028339
Gene Namecollagen, type XV, alpha 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6791 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location47208161-47313167 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 47300518 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1060 (P1060S)
Ref Sequence ENSEMBL: ENSMUSP00000099981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082303] [ENSMUST00000102917] [ENSMUST00000107730] [ENSMUST00000107731] [ENSMUST00000146967]
PDB Structure MURINE COLLAGEN ALPHA1(XV), ENDOSTATIN DOMAIN [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000082303
AA Change: P1038S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080921
Gene: ENSMUSG00000028339
AA Change: P1038S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSPN 40 228 2.53e-56 SMART
LamG 89 227 1.7e-7 SMART
low complexity region 236 251 N/A INTRINSIC
low complexity region 332 344 N/A INTRINSIC
low complexity region 541 567 N/A INTRINSIC
Pfam:Collagen 603 663 1.4e-10 PFAM
Pfam:Collagen 650 719 2.1e-9 PFAM
low complexity region 722 742 N/A INTRINSIC
low complexity region 750 759 N/A INTRINSIC
Pfam:Collagen 782 832 2.7e-10 PFAM
Pfam:Collagen 838 894 5.1e-10 PFAM
low complexity region 965 980 N/A INTRINSIC
low complexity region 1010 1020 N/A INTRINSIC
Pfam:Endostatin 1087 1164 9.3e-15 PFAM
Pfam:Endostatin 1148 1345 1.4e-97 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102917
AA Change: P1060S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099981
Gene: ENSMUSG00000028339
AA Change: P1060S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSPN 40 228 2.53e-56 SMART
LamG 89 227 1.7e-7 SMART
low complexity region 236 251 N/A INTRINSIC
low complexity region 332 344 N/A INTRINSIC
low complexity region 541 567 N/A INTRINSIC
Pfam:Collagen 603 666 5.6e-10 PFAM
Pfam:Collagen 659 720 3.1e-10 PFAM
low complexity region 737 764 N/A INTRINSIC
low complexity region 772 781 N/A INTRINSIC
Pfam:Collagen 804 854 9.5e-10 PFAM
Pfam:Collagen 860 916 1.8e-9 PFAM
low complexity region 987 1002 N/A INTRINSIC
low complexity region 1032 1042 N/A INTRINSIC
low complexity region 1050 1109 N/A INTRINSIC
Pfam:Endostatin 1112 1362 2.8e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107730
SMART Domains Protein: ENSMUSP00000103358
Gene: ENSMUSG00000028339

DomainStartEndE-ValueType
Pfam:Endostatin 20 100 8.7e-16 PFAM
Pfam:Endostatin 83 278 5.7e-99 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107731
AA Change: P226S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103359
Gene: ENSMUSG00000028339
AA Change: P226S

DomainStartEndE-ValueType
Pfam:Collagen 6 81 6.5e-9 PFAM
Pfam:Collagen 48 102 3.8e-8 PFAM
low complexity region 153 168 N/A INTRINSIC
Pfam:Collagen 196 258 4.1e-8 PFAM
Pfam:Endostatin 275 355 2.5e-15 PFAM
Pfam:Endostatin 336 533 2.8e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146967
SMART Domains Protein: ENSMUSP00000118637
Gene: ENSMUSG00000028339

DomainStartEndE-ValueType
Pfam:Collagen 2 55 6.3e-11 PFAM
Pfam:Collagen 96 141 2.9e-7 PFAM
Meta Mutation Damage Score 0.1313 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XV collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Type XV collagen has a wide tissue distribution but the strongest expression is localized to basement membrane zones so it may function to adhere basement membranes to underlying connective tissue stroma. The proteolytically produced C-terminal fragment of type XV collagen is restin, a potentially antiangiogenic protein that is closely related to endostatin. Mouse studies have shown that collagen XV deficiency is associated with muscle and microvessel deterioration. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutation of this gene results in abnormal muscle cells of variable size (including atrophic and split muscle cells), susceptibility to exercise-induced muscle injury, and abnormalities in heart and skeletal muscle capillary endothelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,504 C3526S probably damaging Het
Adgrf2 T C 17: 42,710,883 N350S probably benign Het
Atp12a G A 14: 56,386,982 probably null Het
AW551984 T G 9: 39,600,659 S19R probably damaging Het
Bet1l A G 7: 140,854,505 I77T possibly damaging Het
Cfap206 T C 4: 34,711,414 I494M possibly damaging Het
Cog3 A G 14: 75,730,678 I415T probably damaging Het
Ctrb1 A G 8: 111,689,349 V71A possibly damaging Het
Ddhd2 T C 8: 25,752,215 Y211C probably benign Het
Fbxl20 T C 11: 98,109,510 T128A probably benign Het
Fdps A G 3: 89,095,352 probably null Het
Gm4302 TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA 10: 100,341,499 probably benign Het
Gm8369 T A 19: 11,511,836 probably benign Het
Grm6 T C 11: 50,859,774 V588A possibly damaging Het
Heatr6 T C 11: 83,758,341 L174S probably benign Het
Kif1a G A 1: 93,066,137 P364S probably damaging Het
Klk7 A G 7: 43,813,260 D163G probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Lamb3 T C 1: 193,334,861 S787P possibly damaging Het
Lrp5 C T 19: 3,600,753 C1227Y probably damaging Het
Mgst1 G A 6: 138,141,807 probably benign Het
Mllt6 T C 11: 97,680,602 S1022P probably damaging Het
Mtmr2 T C 9: 13,805,382 I521T probably benign Het
Naalad2 T C 9: 18,385,130 T75A possibly damaging Het
Nadsyn1 A T 7: 143,819,108 I83N probably damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurl4 T A 11: 69,908,510 L904Q probably damaging Het
Ngp A C 9: 110,419,949 I30L probably benign Het
Olfr312 T C 11: 58,832,077 Y308H probably benign Het
Olfr787 G A 10: 129,463,154 M159I probably benign Het
Orm2 A T 4: 63,363,959 M125L probably benign Het
Pax2 A T 19: 44,788,821 D151V possibly damaging Het
Polg A G 7: 79,460,109 V382A probably benign Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Pramef6 T A 4: 143,895,682 I368F probably benign Het
Prss16 A T 13: 22,006,067 V307E probably damaging Het
Prss54 T G 8: 95,564,655 probably null Het
Rspo1 A G 4: 125,007,183 H108R probably benign Het
Sh3bp5l C A 11: 58,346,272 H352N probably damaging Het
Skor1 T C 9: 63,140,354 probably null Het
Smad6 A G 9: 64,012,227 Y289H probably benign Het
Spg11 T C 2: 122,093,443 E799G probably damaging Het
Spg20 G A 3: 55,127,561 G456D probably damaging Het
Tbc1d4 T G 14: 101,608,259 K68Q probably damaging Het
Treml2 A G 17: 48,309,219 M296V probably benign Het
Ugt2b1 C A 5: 86,919,257 D436Y probably damaging Het
Usp9y A T Y: 1,325,042 probably null Homo
Vmn2r6 T C 3: 64,538,159 Y626C probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Zfp131 A G 13: 119,766,593 V506A probably damaging Het
Zfp74 A G 7: 29,934,435 I616T probably benign Het
Other mutations in Col15a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Col15a1 APN 4 47208450 missense possibly damaging 0.86
IGL01561:Col15a1 APN 4 47312118 missense possibly damaging 0.87
IGL01750:Col15a1 APN 4 47303897 missense probably damaging 1.00
IGL02112:Col15a1 APN 4 47253985 splice site probably benign
IGL02158:Col15a1 APN 4 47300606 splice site probably null
IGL02268:Col15a1 APN 4 47245380 missense probably damaging 0.99
IGL02325:Col15a1 APN 4 47289364 missense probably damaging 1.00
IGL02583:Col15a1 APN 4 47279866 missense probably benign 0.00
IGL02699:Col15a1 APN 4 47284471 unclassified probably benign
IGL03167:Col15a1 APN 4 47282635 missense probably damaging 0.99
IGL03174:Col15a1 APN 4 47282666 missense probably damaging 0.99
R0119:Col15a1 UTSW 4 47262950 missense probably damaging 0.98
R0299:Col15a1 UTSW 4 47262950 missense probably damaging 0.98
R0499:Col15a1 UTSW 4 47262950 missense probably damaging 0.98
R0567:Col15a1 UTSW 4 47293231 missense possibly damaging 0.89
R0607:Col15a1 UTSW 4 47282654 missense probably damaging 0.99
R0992:Col15a1 UTSW 4 47300491 missense probably damaging 0.96
R1165:Col15a1 UTSW 4 47257275 splice site probably benign
R1191:Col15a1 UTSW 4 47254083 nonsense probably null
R1852:Col15a1 UTSW 4 47299278 critical splice donor site probably null
R2349:Col15a1 UTSW 4 47306742 missense probably damaging 0.99
R2512:Col15a1 UTSW 4 47245868 missense possibly damaging 0.95
R2517:Col15a1 UTSW 4 47208492 missense probably damaging 0.98
R2895:Col15a1 UTSW 4 47312091 missense possibly damaging 0.59
R3688:Col15a1 UTSW 4 47258689 missense probably benign 0.00
R3848:Col15a1 UTSW 4 47289374 missense possibly damaging 0.73
R4430:Col15a1 UTSW 4 47245705 missense probably damaging 1.00
R4587:Col15a1 UTSW 4 47257184 missense probably damaging 1.00
R4793:Col15a1 UTSW 4 47262997 missense possibly damaging 0.83
R4812:Col15a1 UTSW 4 47262479 missense possibly damaging 0.93
R4922:Col15a1 UTSW 4 47258719 missense probably benign
R5233:Col15a1 UTSW 4 47296112 missense possibly damaging 0.74
R5602:Col15a1 UTSW 4 47312087 missense probably damaging 1.00
R5786:Col15a1 UTSW 4 47280865 missense possibly damaging 0.84
R5910:Col15a1 UTSW 4 47289514 missense probably damaging 1.00
R5921:Col15a1 UTSW 4 47300602 missense probably damaging 0.99
R5974:Col15a1 UTSW 4 47258683 missense probably benign 0.02
R5985:Col15a1 UTSW 4 47284507 missense probably damaging 0.99
R6010:Col15a1 UTSW 4 47245630 missense probably benign 0.03
R6720:Col15a1 UTSW 4 47247552 critical splice donor site probably null
R6855:Col15a1 UTSW 4 47245544 missense probably damaging 1.00
R6965:Col15a1 UTSW 4 47247533 missense probably damaging 0.96
R7201:Col15a1 UTSW 4 47307752 missense possibly damaging 0.92
R7261:Col15a1 UTSW 4 47269088 missense probably benign 0.03
R7273:Col15a1 UTSW 4 47284467 splice site probably null
R7413:Col15a1 UTSW 4 47245431 missense possibly damaging 0.81
R7658:Col15a1 UTSW 4 47245591 missense possibly damaging 0.46
R8032:Col15a1 UTSW 4 47288108 missense unknown
R8075:Col15a1 UTSW 4 47208359 missense probably benign 0.07
R8130:Col15a1 UTSW 4 47312196 missense probably damaging 0.97
R8536:Col15a1 UTSW 4 47208536 critical splice donor site probably null
R8873:Col15a1 UTSW 4 47247552 critical splice donor site probably null
R8887:Col15a1 UTSW 4 47287091 missense probably damaging 1.00
Z1177:Col15a1 UTSW 4 47245807 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATGCCTAGGCTTGCTGGTATC -3'
(R):5'- TTTAAAGAAGATGGGAGGCTCC -3'

Sequencing Primer
(F):5'- GCTTGCTGGTATCTTTGGACTCC -3'
(R):5'- GGCCCTCTATCAAACAAATAGACTG -3'
Posted On2018-08-29