Incidental Mutation 'R6791:Klk7'
ID532584
Institutional Source Beutler Lab
Gene Symbol Klk7
Ensembl Gene ENSMUSG00000030713
Gene Namekallikrein related-peptidase 7 (chymotryptic, stratum corneum)
SynonymsPrss6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6791 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location43811294-43816359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43813260 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 163 (D163G)
Ref Sequence ENSEMBL: ENSMUSP00000032955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032955]
Predicted Effect probably benign
Transcript: ENSMUST00000032955
AA Change: D163G

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000032955
Gene: ENSMUSG00000030713
AA Change: D163G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 25 241 1.47e-90 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,504 C3526S probably damaging Het
Adgrf2 T C 17: 42,710,883 N350S probably benign Het
Atp12a G A 14: 56,386,982 probably null Het
AW551984 T G 9: 39,600,659 S19R probably damaging Het
Bet1l A G 7: 140,854,505 I77T possibly damaging Het
Cfap206 T C 4: 34,711,414 I494M possibly damaging Het
Cog3 A G 14: 75,730,678 I415T probably damaging Het
Col15a1 C T 4: 47,300,518 P1060S probably damaging Het
Ctrb1 A G 8: 111,689,349 V71A possibly damaging Het
Ddhd2 T C 8: 25,752,215 Y211C probably benign Het
Fbxl20 T C 11: 98,109,510 T128A probably benign Het
Fdps A G 3: 89,095,352 probably null Het
Gm4302 TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA 10: 100,341,499 probably benign Het
Gm8369 T A 19: 11,511,836 probably benign Het
Grm6 T C 11: 50,859,774 V588A possibly damaging Het
Heatr6 T C 11: 83,758,341 L174S probably benign Het
Kif1a G A 1: 93,066,137 P364S probably damaging Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Lamb3 T C 1: 193,334,861 S787P possibly damaging Het
Lrp5 C T 19: 3,600,753 C1227Y probably damaging Het
Mgst1 G A 6: 138,141,807 probably benign Het
Mllt6 T C 11: 97,680,602 S1022P probably damaging Het
Mtmr2 T C 9: 13,805,382 I521T probably benign Het
Naalad2 T C 9: 18,385,130 T75A possibly damaging Het
Nadsyn1 A T 7: 143,819,108 I83N probably damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurl4 T A 11: 69,908,510 L904Q probably damaging Het
Ngp A C 9: 110,419,949 I30L probably benign Het
Olfr312 T C 11: 58,832,077 Y308H probably benign Het
Olfr787 G A 10: 129,463,154 M159I probably benign Het
Orm2 A T 4: 63,363,959 M125L probably benign Het
Pax2 A T 19: 44,788,821 D151V possibly damaging Het
Polg A G 7: 79,460,109 V382A probably benign Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Pramef6 T A 4: 143,895,682 I368F probably benign Het
Prss16 A T 13: 22,006,067 V307E probably damaging Het
Prss54 T G 8: 95,564,655 probably null Het
Rspo1 A G 4: 125,007,183 H108R probably benign Het
Sh3bp5l C A 11: 58,346,272 H352N probably damaging Het
Skor1 T C 9: 63,140,354 probably null Het
Smad6 A G 9: 64,012,227 Y289H probably benign Het
Spg11 T C 2: 122,093,443 E799G probably damaging Het
Spg20 G A 3: 55,127,561 G456D probably damaging Het
Tbc1d4 T G 14: 101,608,259 K68Q probably damaging Het
Treml2 A G 17: 48,309,219 M296V probably benign Het
Ugt2b1 C A 5: 86,919,257 D436Y probably damaging Het
Usp9y A T Y: 1,325,042 probably null Homo
Vmn2r6 T C 3: 64,538,159 Y626C probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Zfp131 A G 13: 119,766,593 V506A probably damaging Het
Zfp74 A G 7: 29,934,435 I616T probably benign Het
Other mutations in Klk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0056:Klk7 UTSW 7 43812010 missense possibly damaging 0.96
R1777:Klk7 UTSW 7 43813329 missense probably damaging 1.00
R7313:Klk7 UTSW 7 43812875 missense probably damaging 1.00
R7399:Klk7 UTSW 7 43812000 missense probably benign 0.18
R7549:Klk7 UTSW 7 43812773 splice site probably null
R7867:Klk7 UTSW 7 43812909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTGGGTTCCAGCATAGC -3'
(R):5'- ATCTGAGCCATGACCAGGAC -3'

Sequencing Primer
(F):5'- GGGTTCCAGCATAGCCCTCTC -3'
(R):5'- CAGGCTGGGACTAGAAGCTTTG -3'
Posted On2018-08-29