Incidental Mutation 'R6791:Ddhd2'
ID532588
Institutional Source Beutler Lab
Gene Symbol Ddhd2
Ensembl Gene ENSMUSG00000061313
Gene NameDDHD domain containing 2
Synonyms2010305K11Rik, SAMWD1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R6791 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location25725346-25754596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25752215 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 211 (Y211C)
Ref Sequence ENSEMBL: ENSMUSP00000147859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033975] [ENSMUST00000211009] [ENSMUST00000211688] [ENSMUST00000211751]
Predicted Effect probably benign
Transcript: ENSMUST00000033975
AA Change: Y99C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000033975
Gene: ENSMUSG00000061313
AA Change: Y99C

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Pfam:WWE 40 112 7.5e-9 PFAM
Blast:DDHD 285 357 6e-28 BLAST
SAM 382 447 1.13e-11 SMART
DDHD 484 688 6.63e-75 SMART
Predicted Effect unknown
Transcript: ENSMUST00000210888
AA Change: Y81C
Predicted Effect probably benign
Transcript: ENSMUST00000211009
AA Change: Y99C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000211688
AA Change: Y211C

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000211751
Meta Mutation Damage Score 0.1503 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase enzyme containing sterile-alpha-motif (SAM), WWE, and DDHD domains. This protein participates in membrane trafficking between the endoplastic reticulum and the Golgi body. Mutations in this gene can cause autosomal recessive spastic paraplegia 54. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a null mutation display impaired balance and coordination, impaired spatial learning and memory and triglyceride accumulation in neurons in the brain and spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,504 C3526S probably damaging Het
Adgrf2 T C 17: 42,710,883 N350S probably benign Het
Atp12a G A 14: 56,386,982 probably null Het
AW551984 T G 9: 39,600,659 S19R probably damaging Het
Bet1l A G 7: 140,854,505 I77T possibly damaging Het
Cfap206 T C 4: 34,711,414 I494M possibly damaging Het
Cog3 A G 14: 75,730,678 I415T probably damaging Het
Col15a1 C T 4: 47,300,518 P1060S probably damaging Het
Ctrb1 A G 8: 111,689,349 V71A possibly damaging Het
Fbxl20 T C 11: 98,109,510 T128A probably benign Het
Fdps A G 3: 89,095,352 probably null Het
Gm4302 TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA 10: 100,341,499 probably benign Het
Gm8369 T A 19: 11,511,836 probably benign Het
Grm6 T C 11: 50,859,774 V588A possibly damaging Het
Heatr6 T C 11: 83,758,341 L174S probably benign Het
Kif1a G A 1: 93,066,137 P364S probably damaging Het
Klk7 A G 7: 43,813,260 D163G probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Lamb3 T C 1: 193,334,861 S787P possibly damaging Het
Lrp5 C T 19: 3,600,753 C1227Y probably damaging Het
Mgst1 G A 6: 138,141,807 probably benign Het
Mllt6 T C 11: 97,680,602 S1022P probably damaging Het
Mtmr2 T C 9: 13,805,382 I521T probably benign Het
Naalad2 T C 9: 18,385,130 T75A possibly damaging Het
Nadsyn1 A T 7: 143,819,108 I83N probably damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurl4 T A 11: 69,908,510 L904Q probably damaging Het
Ngp A C 9: 110,419,949 I30L probably benign Het
Olfr312 T C 11: 58,832,077 Y308H probably benign Het
Olfr787 G A 10: 129,463,154 M159I probably benign Het
Orm2 A T 4: 63,363,959 M125L probably benign Het
Pax2 A T 19: 44,788,821 D151V possibly damaging Het
Polg A G 7: 79,460,109 V382A probably benign Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Pramef6 T A 4: 143,895,682 I368F probably benign Het
Prss16 A T 13: 22,006,067 V307E probably damaging Het
Prss54 T G 8: 95,564,655 probably null Het
Rspo1 A G 4: 125,007,183 H108R probably benign Het
Sh3bp5l C A 11: 58,346,272 H352N probably damaging Het
Skor1 T C 9: 63,140,354 probably null Het
Smad6 A G 9: 64,012,227 Y289H probably benign Het
Spg11 T C 2: 122,093,443 E799G probably damaging Het
Spg20 G A 3: 55,127,561 G456D probably damaging Het
Tbc1d4 T G 14: 101,608,259 K68Q probably damaging Het
Treml2 A G 17: 48,309,219 M296V probably benign Het
Ugt2b1 C A 5: 86,919,257 D436Y probably damaging Het
Usp9y A T Y: 1,325,042 probably null Homo
Vmn2r6 T C 3: 64,538,159 Y626C probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Zfp131 A G 13: 119,766,593 V506A probably damaging Het
Zfp74 A G 7: 29,934,435 I616T probably benign Het
Other mutations in Ddhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01501:Ddhd2 APN 8 25735830 missense probably damaging 1.00
IGL01629:Ddhd2 APN 8 25735828 missense possibly damaging 0.91
IGL01656:Ddhd2 APN 8 25727712 missense probably benign 0.34
IGL01723:Ddhd2 APN 8 25735011 nonsense probably null
IGL01820:Ddhd2 APN 8 25749754 missense possibly damaging 0.87
IGL01901:Ddhd2 APN 8 25748594 missense probably damaging 0.96
IGL02619:Ddhd2 APN 8 25746954 critical splice acceptor site probably null
PIT4362001:Ddhd2 UTSW 8 25735752 missense probably damaging 1.00
R0240:Ddhd2 UTSW 8 25739590 splice site probably null
R0240:Ddhd2 UTSW 8 25739590 splice site probably null
R0408:Ddhd2 UTSW 8 25739587 critical splice acceptor site probably null
R0732:Ddhd2 UTSW 8 25741321 missense probably damaging 1.00
R1483:Ddhd2 UTSW 8 25753128 missense probably benign 0.01
R1597:Ddhd2 UTSW 8 25749741 missense probably benign 0.09
R1881:Ddhd2 UTSW 8 25727700 missense probably damaging 0.99
R1927:Ddhd2 UTSW 8 25741661 missense possibly damaging 0.92
R2044:Ddhd2 UTSW 8 25752165 missense probably damaging 1.00
R4494:Ddhd2 UTSW 8 25738234 missense probably benign 0.01
R4728:Ddhd2 UTSW 8 25752267 missense probably damaging 1.00
R5044:Ddhd2 UTSW 8 25752137 missense probably damaging 1.00
R5138:Ddhd2 UTSW 8 25727699 missense probably damaging 1.00
R5529:Ddhd2 UTSW 8 25739560 missense probably benign 0.00
R5761:Ddhd2 UTSW 8 25741699 missense probably benign 0.19
R5799:Ddhd2 UTSW 8 25748602 missense probably damaging 1.00
R5934:Ddhd2 UTSW 8 25753113 missense probably damaging 1.00
R5965:Ddhd2 UTSW 8 25735777 missense probably damaging 1.00
R5988:Ddhd2 UTSW 8 25748562 missense probably damaging 1.00
R6260:Ddhd2 UTSW 8 25752117 missense probably benign 0.00
R7386:Ddhd2 UTSW 8 25754290 missense possibly damaging 0.53
R7470:Ddhd2 UTSW 8 25735060 missense probably benign 0.06
R7911:Ddhd2 UTSW 8 25748536 critical splice donor site probably null
R8153:Ddhd2 UTSW 8 25750789 missense probably benign 0.16
R8385:Ddhd2 UTSW 8 25735014 missense probably damaging 0.99
Z1176:Ddhd2 UTSW 8 25735829 missense possibly damaging 0.61
Z1177:Ddhd2 UTSW 8 25754374 missense probably benign
Z1177:Ddhd2 UTSW 8 25754385 missense unknown
Predicted Primers PCR Primer
(F):5'- GACCTCTTCCTGGAAGTTTCACAC -3'
(R):5'- ATGTAGCCAAGTGGAGCCTG -3'

Sequencing Primer
(F):5'- CACACGGTCTGTTAGAATTGGGAC -3'
(R):5'- TAGCCAAGTGGAGCCTGTGTAC -3'
Posted On2018-08-29