Incidental Mutation 'R6791:Naalad2'
ID532592
Institutional Source Beutler Lab
Gene Symbol Naalad2
Ensembl Gene ENSMUSG00000043943
Gene NameN-acetylated alpha-linked acidic dipeptidase 2
SynonymsNAADALASE2, GCP3, NAALADASE2, Folh1b, GCPIII, D9Ertd285e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.568) question?
Stock #R6791 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location18321951-18402995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18385130 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 75 (T75A)
Ref Sequence ENSEMBL: ENSMUSP00000133157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001826] [ENSMUST00000101453] [ENSMUST00000164081] [ENSMUST00000166825] [ENSMUST00000172116] [ENSMUST00000172171]
Predicted Effect probably benign
Transcript: ENSMUST00000001826
AA Change: T75A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000001826
Gene: ENSMUSG00000043943
AA Change: T75A

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
Pfam:PA 198 290 2.2e-14 PFAM
Pfam:Peptidase_M28 385 593 9.4e-22 PFAM
Pfam:TFR_dimer 655 775 1.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101453
Predicted Effect probably benign
Transcript: ENSMUST00000164081
Predicted Effect probably benign
Transcript: ENSMUST00000166825
AA Change: T37A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128674
Gene: ENSMUSG00000043943
AA Change: T37A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:PA 155 253 2.8e-14 PFAM
Pfam:Peptidase_M28 360 554 8.2e-18 PFAM
Pfam:TFR_dimer 616 739 3.8e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172116
AA Change: T75A

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133157
Gene: ENSMUSG00000043943
AA Change: T75A

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172171
AA Change: T75A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130752
Gene: ENSMUSG00000043943
AA Change: T75A

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
Pfam:PA 193 291 3.5e-14 PFAM
Pfam:Peptidase_M28 398 592 1.2e-17 PFAM
Pfam:TFR_dimer 654 777 6.4e-42 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the N-acetylated alpha-linked acidic dipeptidase (NAALADase) gene family. The representative member of this family is the gene encoding human prostate-specific membrane antigen (PSM), which is a marker of prostatic carcinomas and is the first to be shown to possess NAALADase activity. NAALADase cleaves N-acetyl-L-aspartate-L-glutamate (NAAG), which is a neuropeptide expressed both in the central nervous systems and in the periphery and is thought to function as a neurotransmitter. The product of this gene is a type II integral membrane protein. Transient transfection of this gene confers both NAALADase and dipetidyl peptidase IV activities to mammalian cells. This gene is highly expressed in ovary and testis as well as within discrete brain areas. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,504 C3526S probably damaging Het
Adgrf2 T C 17: 42,710,883 N350S probably benign Het
Atp12a G A 14: 56,386,982 probably null Het
AW551984 T G 9: 39,600,659 S19R probably damaging Het
Bet1l A G 7: 140,854,505 I77T possibly damaging Het
Cfap206 T C 4: 34,711,414 I494M possibly damaging Het
Cog3 A G 14: 75,730,678 I415T probably damaging Het
Col15a1 C T 4: 47,300,518 P1060S probably damaging Het
Ctrb1 A G 8: 111,689,349 V71A possibly damaging Het
Ddhd2 T C 8: 25,752,215 Y211C probably benign Het
Fbxl20 T C 11: 98,109,510 T128A probably benign Het
Fdps A G 3: 89,095,352 probably null Het
Gm4302 TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA 10: 100,341,499 probably benign Het
Gm8369 T A 19: 11,511,836 probably benign Het
Grm6 T C 11: 50,859,774 V588A possibly damaging Het
Heatr6 T C 11: 83,758,341 L174S probably benign Het
Kif1a G A 1: 93,066,137 P364S probably damaging Het
Klk7 A G 7: 43,813,260 D163G probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Lamb3 T C 1: 193,334,861 S787P possibly damaging Het
Lrp5 C T 19: 3,600,753 C1227Y probably damaging Het
Mgst1 G A 6: 138,141,807 probably benign Het
Mllt6 T C 11: 97,680,602 S1022P probably damaging Het
Mtmr2 T C 9: 13,805,382 I521T probably benign Het
Nadsyn1 A T 7: 143,819,108 I83N probably damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurl4 T A 11: 69,908,510 L904Q probably damaging Het
Ngp A C 9: 110,419,949 I30L probably benign Het
Olfr312 T C 11: 58,832,077 Y308H probably benign Het
Olfr787 G A 10: 129,463,154 M159I probably benign Het
Orm2 A T 4: 63,363,959 M125L probably benign Het
Pax2 A T 19: 44,788,821 D151V possibly damaging Het
Polg A G 7: 79,460,109 V382A probably benign Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Pramef6 T A 4: 143,895,682 I368F probably benign Het
Prss16 A T 13: 22,006,067 V307E probably damaging Het
Prss54 T G 8: 95,564,655 probably null Het
Rspo1 A G 4: 125,007,183 H108R probably benign Het
Sh3bp5l C A 11: 58,346,272 H352N probably damaging Het
Skor1 T C 9: 63,140,354 probably null Het
Smad6 A G 9: 64,012,227 Y289H probably benign Het
Spg11 T C 2: 122,093,443 E799G probably damaging Het
Spg20 G A 3: 55,127,561 G456D probably damaging Het
Tbc1d4 T G 14: 101,608,259 K68Q probably damaging Het
Treml2 A G 17: 48,309,219 M296V probably benign Het
Ugt2b1 C A 5: 86,919,257 D436Y probably damaging Het
Usp9y A T Y: 1,325,042 probably null Homo
Vmn2r6 T C 3: 64,538,159 Y626C probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Zfp131 A G 13: 119,766,593 V506A probably damaging Het
Zfp74 A G 7: 29,934,435 I616T probably benign Het
Other mutations in Naalad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Naalad2 APN 9 18327373 missense probably damaging 0.97
IGL02160:Naalad2 APN 9 18379937 missense probably damaging 1.00
IGL03246:Naalad2 APN 9 18385099 missense possibly damaging 0.92
IGL03351:Naalad2 APN 9 18364187 missense possibly damaging 0.57
ithaca UTSW 9 18378699 missense probably damaging 1.00
odysseus UTSW 9 18376533 missense possibly damaging 0.63
R0112:Naalad2 UTSW 9 18351447 nonsense probably null
R0266:Naalad2 UTSW 9 18350943 splice site probably benign
R0505:Naalad2 UTSW 9 18385895 missense probably benign
R1077:Naalad2 UTSW 9 18347506 missense probably damaging 1.00
R1442:Naalad2 UTSW 9 18351032 splice site probably benign
R1553:Naalad2 UTSW 9 18378669 missense probably benign 0.01
R1694:Naalad2 UTSW 9 18327387 missense probably damaging 0.96
R1912:Naalad2 UTSW 9 18376535 missense probably benign 0.00
R1976:Naalad2 UTSW 9 18378699 missense probably damaging 1.00
R2224:Naalad2 UTSW 9 18376533 missense possibly damaging 0.63
R2225:Naalad2 UTSW 9 18376533 missense possibly damaging 0.63
R2227:Naalad2 UTSW 9 18376533 missense possibly damaging 0.63
R2287:Naalad2 UTSW 9 18335021 splice site probably null
R4126:Naalad2 UTSW 9 18347470 missense probably damaging 1.00
R4784:Naalad2 UTSW 9 18350918 missense probably damaging 1.00
R5426:Naalad2 UTSW 9 18347519 missense probably benign 0.11
R5470:Naalad2 UTSW 9 18330851 missense probably damaging 1.00
R5644:Naalad2 UTSW 9 18334931 missense possibly damaging 0.90
R5888:Naalad2 UTSW 9 18330641 missense probably benign 0.34
R6194:Naalad2 UTSW 9 18351147 missense probably benign 0.23
R6238:Naalad2 UTSW 9 18385065 missense probably damaging 1.00
R6701:Naalad2 UTSW 9 18385148 missense probably null 0.05
R6764:Naalad2 UTSW 9 18402889 start gained probably benign
R7133:Naalad2 UTSW 9 18327377 missense probably benign 0.00
R7137:Naalad2 UTSW 9 18323487 missense probably benign 0.00
R7212:Naalad2 UTSW 9 18364041 splice site probably null
R7588:Naalad2 UTSW 9 18351479 missense probably damaging 0.99
R8024:Naalad2 UTSW 9 18397473 splice site probably benign
R8409:Naalad2 UTSW 9 18330838 missense probably damaging 1.00
R8413:Naalad2 UTSW 9 18330643 missense probably damaging 0.99
Z1177:Naalad2 UTSW 9 18351102 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATCCCCAGTGATATAGACAC -3'
(R):5'- AAGCCTGCACAATGATCTGTTG -3'

Sequencing Primer
(F):5'- TACGCTTGCTCATGCAA -3'
(R):5'- GCACAATGATCTGTTGGTTATTATTG -3'
Posted On2018-08-29