Incidental Mutation 'R6791:Sh3bp5l'
ID532601
Institutional Source Beutler Lab
Gene Symbol Sh3bp5l
Ensembl Gene ENSMUSG00000013646
Gene NameSH3 binding domain protein 5 like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R6791 (G1)
Quality Score166.009
Status Validated
Chromosome11
Chromosomal Location58330724-58347728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58346272 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 352 (H352N)
Ref Sequence ENSEMBL: ENSMUSP00000112077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073128] [ENSMUST00000116376]
Predicted Effect probably damaging
Transcript: ENSMUST00000073128
AA Change: H352N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072872
Gene: ENSMUSG00000013646
AA Change: H352N

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
Pfam:SH3BP5 52 289 1.3e-103 PFAM
low complexity region 296 337 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000116376
AA Change: H352N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112077
Gene: ENSMUSG00000013646
AA Change: H352N

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
Pfam:SH3BP5 54 280 2.5e-97 PFAM
low complexity region 296 337 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,504 C3526S probably damaging Het
Adgrf2 T C 17: 42,710,883 N350S probably benign Het
Atp12a G A 14: 56,386,982 probably null Het
AW551984 T G 9: 39,600,659 S19R probably damaging Het
Bet1l A G 7: 140,854,505 I77T possibly damaging Het
Cfap206 T C 4: 34,711,414 I494M possibly damaging Het
Cog3 A G 14: 75,730,678 I415T probably damaging Het
Col15a1 C T 4: 47,300,518 P1060S probably damaging Het
Ctrb1 A G 8: 111,689,349 V71A possibly damaging Het
Ddhd2 T C 8: 25,752,215 Y211C probably benign Het
Fbxl20 T C 11: 98,109,510 T128A probably benign Het
Fdps A G 3: 89,095,352 probably null Het
Gm4302 TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA 10: 100,341,499 probably benign Het
Gm8369 T A 19: 11,511,836 probably benign Het
Grm6 T C 11: 50,859,774 V588A possibly damaging Het
Heatr6 T C 11: 83,758,341 L174S probably benign Het
Kif1a G A 1: 93,066,137 P364S probably damaging Het
Klk7 A G 7: 43,813,260 D163G probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Lamb3 T C 1: 193,334,861 S787P possibly damaging Het
Lrp5 C T 19: 3,600,753 C1227Y probably damaging Het
Mgst1 G A 6: 138,141,807 probably benign Het
Mllt6 T C 11: 97,680,602 S1022P probably damaging Het
Mtmr2 T C 9: 13,805,382 I521T probably benign Het
Naalad2 T C 9: 18,385,130 T75A possibly damaging Het
Nadsyn1 A T 7: 143,819,108 I83N probably damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurl4 T A 11: 69,908,510 L904Q probably damaging Het
Ngp A C 9: 110,419,949 I30L probably benign Het
Olfr312 T C 11: 58,832,077 Y308H probably benign Het
Olfr787 G A 10: 129,463,154 M159I probably benign Het
Orm2 A T 4: 63,363,959 M125L probably benign Het
Pax2 A T 19: 44,788,821 D151V possibly damaging Het
Polg A G 7: 79,460,109 V382A probably benign Het
Ppargc1b C A 18: 61,307,676 G724W probably damaging Het
Pramef6 T A 4: 143,895,682 I368F probably benign Het
Prss16 A T 13: 22,006,067 V307E probably damaging Het
Prss54 T G 8: 95,564,655 probably null Het
Rspo1 A G 4: 125,007,183 H108R probably benign Het
Skor1 T C 9: 63,140,354 probably null Het
Smad6 A G 9: 64,012,227 Y289H probably benign Het
Spg11 T C 2: 122,093,443 E799G probably damaging Het
Spg20 G A 3: 55,127,561 G456D probably damaging Het
Tbc1d4 T G 14: 101,608,259 K68Q probably damaging Het
Treml2 A G 17: 48,309,219 M296V probably benign Het
Ugt2b1 C A 5: 86,919,257 D436Y probably damaging Het
Usp9y A T Y: 1,325,042 probably null Homo
Vmn2r6 T C 3: 64,538,159 Y626C probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Zfp131 A G 13: 119,766,593 V506A probably damaging Het
Zfp74 A G 7: 29,934,435 I616T probably benign Het
Other mutations in Sh3bp5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Sh3bp5l APN 11 58346060 missense probably benign 0.01
IGL01503:Sh3bp5l APN 11 58338001 missense probably damaging 1.00
IGL01903:Sh3bp5l APN 11 58346038 missense probably damaging 0.96
IGL02556:Sh3bp5l APN 11 58346261 missense probably damaging 1.00
IGL02755:Sh3bp5l APN 11 58338003 missense probably benign
R0746:Sh3bp5l UTSW 11 58346347 missense probably benign 0.06
R1801:Sh3bp5l UTSW 11 58346351 missense probably benign
R4646:Sh3bp5l UTSW 11 58346351 missense probably benign
R5049:Sh3bp5l UTSW 11 58338124 intron probably benign
R5715:Sh3bp5l UTSW 11 58346015 missense possibly damaging 0.81
R6882:Sh3bp5l UTSW 11 58331699 missense probably benign
R7251:Sh3bp5l UTSW 11 58341302 missense probably damaging 1.00
R7762:Sh3bp5l UTSW 11 58345928 critical splice acceptor site probably null
R8200:Sh3bp5l UTSW 11 58331859 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGAGGGCATTGAGGATG -3'
(R):5'- CAGGACTGAGACAGCTGATC -3'

Sequencing Primer
(F):5'- GGCATTGAGGATGGGGAC -3'
(R):5'- ACTGAGACAGCTGATCCTGCC -3'
Posted On2018-08-29